Notes about COVID origins - sars2.net

First published 2024-04-02 UTC, last modified 2026-05-03 UTC

Contents

Monali Rahalkar: 98.6% nucleotide identity in the partial RdRp fragment of RaTG13 is not unusual

In the 370-base partial RdRp sequence of 4991/RaTG13 which was published in 2016, there's 5 nucleotide changes and 1 amino acid change from Wuhan-Hu-1. So it has about 98.6% nucleotide identity with Wuhan-Hu-1 even though the whole genome of RaTG13 only has 96.1% identity, so people like Monali Rahalkar have been speculating that the rest of the genome of RaTG13 was fabricated to make it appear to be more distant to SARS2: [https://x.com/MonaRahalkar/status/1677549206150496256]

WIV had deposited RdRp and ORF8 submission of 4991 in 2018 and so when they sequenced sars2 they should have found 4991 RdRp of almost 3000 bases with 98 percent and protein match should be 99 or more. What's the guarantee that the rest was not that close too! Did they distance it

Was this the reason Shi lost her sleep that 4991 RdRp was 98 percent and on aa much more closer to sars2. So little tampering of this sequence into a synthetic or serial passage could result in a lab made sars2, and people would suspect them?

When the RaTG13 sequence came out on 27 Jan 2020, it was about 96.2 percent similar. Did they adjust it at other places so that the average came low? It's like 98, 99 percent marks in many subjects and S protein 93 lowering the average marks to 96.2%?

However in the paper by Ge et al. from 2016 where the RdRp fragment was published, it was specifically called the "conserved 440-bp RdRp fragment": "Only two sequences detected in this study were homologous to betacoronaviruses. One of them (RaBtCoV/4991) was detected in a R. affinis sample and was related to SL-CoV. The conserved 440-bp RdRp fragment of RaBt-CoV/4991 had 89% nt identity and 95% aa identity with SL-CoV Rs672 (Yuan et al., 2010)." [https://link.springer.com/content/pdf/10.1007/s12250-016-3713-9.pdf] In the paper they also sequenced the same region from alphacoronaviruses, and it is one of the regions that is the most similar between alphacoronaviruses and betacoronaviruses.

The same region was also sequenced in the "discovery of a rich gene pool" paper by Hu et al. from 2016: "A total of 602 alimentary specimens (anal swabs or feces) were collected and tested for the presence of CoVs by a Pan-CoV RT-PCR targeting the 440-nt RdRp fragment that is conserved among all known α- and β-CoVs [20]." [https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1006698]

In the region of the RdRp fragment of RaTG13, for example Tor2 has only 3 nucleotide changes from WIV1 and SHC014, even though it has about 93-95% identity to them in the whole genome (but here the identity is a bit higher because I ignored positions where either sequence had a gap and I did a big multiple sequence alignment). Here the first column shows the number of nucleotide changes in the region of the partial RdRp sequence of 4991, and the second column shows the identity percentage in the whole genome:

$ curl -sL sars2.net/f/sarbe.fa.xz|gzip -dc>sarbe.fa;seqkit seq -g sarbe.fa>sarbe.ungap
$ wget sars2.net/f/sarbe.pid
$ bow()([[ -e $1.1.bt2 ]]||bowtie2-build --threads 3 "$1" "$1";bowtie2 --no-unal -p3 -x "$@")
$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=KP876546'>4991.fa
$ bow sarbe.ungap -fU 4991.fa -a --score-min L,-1.5,-1.5|grep -v ^@|ruby -ane'puts [$F[2],$F[3],$F[3].to_i+$F[5].scan(/\d+(?=[MD])/).map(&:to_i).sum-1]*" "'|while read l m n;do seqkit grep -p $l sarbe.ungap|seqkit subseq -r $m:$n;done|seqkit grep -nrvp 'SARS coronavirus ZJ01'|mafft --quiet --thread 4 ->temp
$ x=Tor2;cat <(seqkit grep -nrp $x temp) temp|sed 's/\(,\| surface\).*//'|seqkit fx2tab|awk -F\\t 'NR==1{split($2,a,"");next}{split($2,b,"");d=0;for(i=1;i<=length;i++)if(a[i]!=b[i])d++;print d,$1}'|sort -n|awk 'NR==FNR{a[$2]=$1;next}{$1=$1"\t"a[$2]}1' <(awk -F\\t 'NR==1{for(i=2;i<=NF;i++)if($i~x)break;next}{print$i,$1}' x="$x" sarbe.pid) -|sed 's/ /\t/'|awk '$2==100||($2<98&&$0!~/SARS coronavirus/)'|head|column -ts$'\t'
0  100.0000  NC_004718.3 SARS coronavirus Tor2
1  93.5641   KP886808.1 Bat SARS-like coronavirus YNLF_31C
1  93.5506   KP886809.1 Bat SARS-like coronavirus YNLF_34C
2  92.0783   KU973692.1 UNVERIFIED: Severe acute respiratory syndrome-related coronavirus isolate F46
2  93.9236   KY417148.1 Bat SARS-like coronavirus isolate Rs4247
3  95.4596   KC881005.1 Bat SARS-like coronavirus RsSHC014
3  95.7228   KC881006.1 Bat SARS-like coronavirus Rs3367
3  95.6781   KF367457.1 Bat SARS-like coronavirus WIV1
3  95.8298   KY417144.1 Bat SARS-like coronavirus isolate Rs4084
3  93.8966   KY417149.1 Bat SARS-like coronavirus isolate Rs4255

RhGB05 and RhGB06 have only 1 nucleotide change in the region, but they have about 97% identity in the whole genome.

For example Anlong-112 also has 1-3 nucleotide changes in the same region with all the viruses in this simplot, even though the identity in the whole genome is around 90-96%:

Rahalkar also posted a screenshot of a SARS2 sample from 2024 at BLAST which had only 3 nucleotide changes from the 370-base RdRp fragment of 4991, and she wrote: "So now the virus is mutating back to the ancestor! Because the three base diff is a recent most sequence." [https://x.com/MonaRahalkar/status/1787859480459235726] However BLAST has millions of SARS2 samples, so just because one sample from 2024 has only 3 mutations doesn't mean it would be typical of all samples from 2024. NextStrain's global subset of SARS2 samples included 450 samples from 2024, but only one of the samples had 4 mutations in the 370-base region, 390 samples had 5 mutations, 56 had 6, and 3 had 7. So the average was higher than 5:

$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=KP876546'>4991.fa
$ curl https://data.nextstrain.org/files/ncov/open/global/aligned.fasta.xz|gzip -dc>global.fa
$ seqkit locate -f4991.fa -m8 <(seqkit head -n1 global.fa)|sed 1d|cut -f5,6|seqkit subseq -r $(tr \\t :) global.fa|seqkit grep -nrp '2024$'|seqkit grep -svp N|cat 4991.fa -|seqkit seq -s|awk 'NR==1{split($0,a,"");l=length;next}{split($0,b,"");d=0;for(i=1;i<=l;i++)if(a[i]!=b[i])d++;n[d]++}END{for(i in n)print i,n[i]}'
4 1
5 390
6 56
7 3

Limeng Yan: 100% amino acid identity of the envelope protein of ZC45

Limeng Yan was making a big deal out of how the envelope protein of ZC45 had 100% amino acid identity to SARS2: [https://zenodo.org/records/4028830]

The E protein is tolerant of mutations as evidenced in both SARS (Figure 2A) and related bat coronaviruses (Figure 2B). This tolerance to amino acid mutations of the E protein is further evidenced in the current SARS-CoV-2 pandemic. After only a short two-month spread of the virus since its outbreak in humans, the E proteins in SARS-CoV-2 have already undergone mutational changes. Sequence data obtained during the month of April reveals that mutations have occurred at four different locations in different strains (Figure 2C). Consistent with this finding, sequence blast analysis indicates that, with the exception of SARS-CoV-2, no known coronaviruses share 100% amino acid sequence identity on the E protein with ZC45/ZXC21 (suspicious coronaviruses published after the start of the current pandemic are excluded[18,27-31]), Although 100% identity on the E protein has been observed between SARS-CoV and certain SARS-related bat coronaviruses, none of those pairs simultaneously share over 83% identity on the Orf8 protein[32]. Therefore, the 94.2% identity on the Orf8 protein, 100% identity on the E protein, and the overall genomic/amino acid-level resemblance between SARS-CoV-2 and ZC45/ZXC21 are highly unusual. Such evidence, when considered together, is consistent with a hypothesis that the SARS-CoV-2 genome has an origin based on the use of ZC45/ZXC21 as a backbone and/or template for genetic gain-of-function modifications.

But if SARS1 has an identical envelope protein on the amino acid level with viruses where the ORF8 is less than 83% identical, then it suggests that there's nothing unusual if there's 100% aa identity for the envelope proteins of viruses that are not closely related.

The envelope protein of BtKY72 also has 100% amino acid identity to other African sarbecoviruses even though they only have about 85% nucleotide identity in the whole genome:

$ curl -sL sars2.net/f/sarbe.fa.xz|gzip -dc>sarbe.fa;wget sars2.net/f/sarbe.pid
$ emu()(curl -sd "id=$(paste -sd,)" "https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=${1:-nuccore}&rettype=${2:-fasta}&retmode=$3")
$ seqkit seq -ni sarbe.fa|emu '' fasta_cds_aa|seqkit grep -nrp 'gene=E\b|envelope|protein=E\b'>env.aa
$ sed 's/lcl|//;s/_prot.*//' env.aa|seqkit fx2tab|awk -F\\t 'NR==FNR{a[$1]=$2;next}{print">"$1" "a[$1]"\n"$2}' <(seqkit seq -n sarbe.fa|sed $'s/ /\t/;s/\(,\| surface\| ORF1\).*//') ->env2.aa
$ masog()(awk -F\\t 'NR==1{for(i=2;i<=NF;i++)if($i~x)break;next}{print$i,$1}' x="$1" "${2--}"|sort -n)
$ pid0()(seqkit fx2tab "$@"|awk -F\\t 'NR==1{split($2,a,"");l=length;next}{split($2,b,"");d=0;n=0;for(i=1;i<=l;i++){n++;if(a[i]!=b[i])d++}print 100*(1-d/n),$1}')
$ x=BtKY72;seqkit grep -nrp $x env2.aa|cat - env2.aa|pid0|sort -rn|awk 'NR==FNR{a[$2]=$1;next}{$1=$1" "a[$2]}1' <(masog $x sarbe.pid) -|head
100 85.3537 MT726045.1 Sarbecovirus sp. isolate PREDICT/PRD-0038/AABSMF
100 85.4618 MT726044.1 Bat coronavirus isolate PREDICT/PDF-2370/OTBA35RSV
100 85.4618 MT726043.1 Sarbecovirus sp. isolate PREDICT/PDF-2386/OTBA40RSV
100 100.0000 KY352407.1 Severe acute respiratory syndrome-related coronavirus strain BtKY72
99.359 81.7080 MZ190137.1 Bat SARS-like coronavirus Khosta-1 strain BtCoV/Khosta-1/Rh/Russia/2020
97.4359 78.1437 OR233314.1 Horseshoe bat sarbecovirus isolate Rt22SL92
97.4359 78.1471 OR233313.1 Horseshoe bat sarbecovirus isolate Rt22SL85
97.4359 78.1471 OR233312.1 Horseshoe bat sarbecovirus isolate Rt22SL58
97.4359 78.1437 OR233311.1 Horseshoe bat sarbecovirus isolate Rt22SL130
97.4359 78.0657 OR233303.1 Horseshoe bat sarbecovirus isolate Rt22SL9

Tor2 and HKU3 also have an identical envelope protein on the amino acid level even though they only have about 88% nucleotide identity in the whole genome (in a multiple sequence alignment where positions where either sequence has a gap are ignored):

$ x=Tor2;seqkit grep -nrp $x env2.aa|cat - env2.aa|pid0|sort -rn|awk 'NR==FNR{a[$2]=$1;next}{$1=$1" "a[$2]}1' <(masog $x sarbe.pid) -|awk '$1==100'|sort -nk2|head
100 82.2274 OR233309.1 Horseshoe bat sarbecovirus isolate Rt22SL67
100 88.0533 DQ084199.1 bat SARS coronavirus HKU3-2
100 88.0562 DQ084200.1 bat SARS coronavirus HKU3-3
100 88.0597 DQ022305.2 Bat SARS coronavirus HKU3-1
100 88.1371 OK017837.1 Sarbecovirus sp. isolate JX2021C
100 88.2051 OK017801.1 Sarbecovirus sp. isolate HB2020D
100 88.2333 OK017845.1 Sarbecovirus sp. isolate JX2021P
100 88.2441 OK017808.1 Sarbecovirus sp. isolate FJ2021A
100 88.3719 OK017844.1 Sarbecovirus sp. isolate JX2021O
100 88.3878 OQ503499.1 Severe acute respiratory syndrome-related coronavirus isolate RsHB190371

The novel HKU3-like virus mentioned in DRASTIC's HZAU paper was published in 2023 as RsGD2014A/RsGD2014B

The paper by DRASTIC titled "Unexpected novel Merbecovirus discoveries in agricultural sequencing datasets from Wuhan, China" said: [https://europepmc.org/article/PPR/PPR353109]

A significant amount of reads of a SARS-r CoV most closely related to HKU3 was identified in a Mus Musculus splenocyte RNA-seq sequencing dataset SRR5819071 in BioProject PRJNA393936. The novel bat SARS-like HKU3-related CoV was identified via BLAST analysis of the dataset, with the reads only 96-98% similar to their closest related GenBank sequences (Supp. Fig. 27, Supp. Table 4). Although the sequences are far too few to be assembled, the presence of transcription regulatory sequence (TRS)-leader associated fusion reads between the TRS-leader and the TRS-N gene suggest active replication of the HKU3-r CoV within the Mus Musculus splenocyte sample.

Even though most of the other runs discussed in the paper were submitted by Huazhong Agricultural University or Fujian Agriculture and Forestry University, the SRR5819071 run which contained the HKU3-like virus was submitted by WIV.

When I aligned the reads in the run against sarbecovirus sequences, I got the highest number of covered bases for the isolates 141376 and 141341 which were published in 2023, and the average error rates for them were only about 0.40% and 0.08%:

$ curl -sL sars2.net/f/sarbe.fa.xz|gzip -dc>sarbe.fa
$ seqkit seq -g sarbe.fa|seqkit fx2tab|sed $'s/A*\t$//'|seqkit tab2fx|bbmask.sh window=20 in=stdin out=sarbe.mask
$ bowtie2-build --threads 3 sarbe.fa{,}
$ x=SRR5819071;bowtie2 -p 3 --no-unal -x sarbe.mask -1 ${x}_1.fastq.gz -2 ${x}_2.fastq.gz --score-min L,-1,-1|samtools sort -@3 ->$x.sarbe.bam
$ covera()(samtools coverage "$1"|awk \$4|cut -f1,3-6|(gsed -u '1s/$/\terr%\tname/;q';sort -rnk5|awk -F\\t -v OFS=\\t 'NR==FNR{a[$1]=$2;next}{print$0,sprintf("%.2f",a[$1])}' <(samtools view $x|awk -F\\t '{x=$3;n[x]++;len[x]+=length($10);sub(/.*NM:i:/,"");mis[x]+=$1}END{for(i in n)print i"\t"100*mis[i]/len[i]}') -|awk -F\\t 'NR==FNR{a[$1]=$2;next}{print$0"\t"a[$1]}' <(seqkit seq -n "${2-~/viral.fa}"|gsed 's/ /\t/;s/,.*//') -)|column -ts$'\t')
$ covera $x.sarbe.bam sarbe.mask
#rname     endpos numreads covbases coverage err%  name
OQ503496.1 29646  10       1355     4.5706   0.40  Severe acute respiratory syndrome-related coronavirus isolate 141376
OQ503495.1 29657  8        837      2.82227  0.08  Severe acute respiratory syndrome-related coronavirus isolate 141341
OQ297705.1 30029  846586   350      1.16554  6.01  MAG: Severe acute respiratory syndrome-related coronavirus isolate CQ/L80.18/2021
OP776339.1 30600  3        234      0.764706 15.93 Sarbecovirus sp. isolate RhGB05
OQ297732.1 29568  2        200      0.676407 1.33  MAG: Severe acute respiratory syndrome-related coronavirus isolate GD/L105.18/2022
OK017815.1 29550  2        193      0.65313  0.33  Sarbecovirus sp. isolate GD2017I
KF294457.1 29676  2        182      0.61329  0.00  Bat SARS-like coronavirus isolate Longquan-140 orf1ab polyprotein
OL674076.1 29780  116980   159      0.533915 20.76 Severe acute respiratory syndrome-related coronavirus isolate Rs7907
OK017841.1 29350  1        150      0.511073 0.67  Sarbecovirus sp. isolate JX2021L
OQ503500.1 30385  146      151      0.496956 21.70 Severe acute respiratory syndrome-related coronavirus isolate 4105
OQ503498.1 30172  2        137      0.454063 16.33 Severe acute respiratory syndrome-related coronavirus isolate BDA190366
KY417144.1 29770  2        132      0.443399 0.00  Bat SARS-like coronavirus isolate Rs4084
OK017842.1 29337  2        120      0.40904  0.00  Sarbecovirus sp. isolate JX2021M
OQ503504.1 30325  11539    118      0.389118 22.24 Severe acute respiratory syndrome-related coronavirus isolate 162173

When I ran MEGAHIT on the reads which aligned against sarbecoviruses, my longest contig was 535 bases long and it was 100% identical to both 141376 and 141341:

x=SRR5819071;samtools view $x.sarbe.bam|grep -Ev 'OQ297705|OL674076|OQ503504'|cut -f1,10|seqkit tab2fx>temp.fa
megahit -r temp.fa --min-count 1 -o megatemp;seqkit sort -lr megatemp/final.contigs.fa

The 141376 and 141341 isolates actually have over 5% nucleotide distance from HKU3:

The 141376 and 141341 isolates were published in a paper by WIV titled "Isolation of ACE2-dependent and -independent sarbecoviruses from Chinese horseshoe bats", where the corresponding authors were Zhengli Shi and Michael Letko. [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10537568/] In the paper the isolates were given the identifiers RsGD2014A and RsGD2014B. Supplementary Table 1 says that RsGD2014A and RsGD2014B are identical (even though at GenBank 141376 has two nucleotide changes from 141341, but I guess they're still virtually identical):

RsGD2014A seems to have some S1 recombination action going on, which is totally unexpected from a virus published by the WIV. The NTD is virtually identical to GD2017H and RaCH025:

If RsGD2014A is compared to GD2017H, there are also breakpoints in the slope of cumulative synonymous mutations near the start and end of the RBD:

The HA segment in WIV07-2 matches the 2013 refseq but other segments match newer strains of H7N9

In 2021 Steven Quay et al. published a preprint which showed that in the raw reads of samples from early COVID patients published by WIV, there were also reads which contained the HA segment of influenza A within a pVAC1 expression vector: https://www.researchgate.net/publication/353117424_CONTAMINATION_OR_VACCINE_RESEARCH_RNA_Sequencing_data_of_early_COVID-19_patient_samples_show_abnormal_presence_of_vectorized_H7N9_hemagglutinin_segment. Influenza viruses are segmented viruses which contain a total of 8 segments, similar to how the human genome is divided into chromosomes. Segment 4 codes for the hemagglutin protein, which is the equivalent of the spike protein in coronaviruses.

The WIV reads also contained a much smaller number of reads for other segments of H7N9, even though Quay wrote: "Mr. Cullen fails to state that the H7N9 sequences found in the patients were one gene only, attached to a laboratory vector." [https://x.com/quay_dr/status/1762247581726581006] However later he corrected himself and wrote: "Correction: 5 of 6 did not have all of the influenza genes. 1 of 6 had all of the genes but non-HA genes at <2% of HA. HA is in a synthetic vector as in a vaccine." [https://x.com/quay_dr/status/1787117752089792778]

The run with the highest number of H7N9 reads has the ID WIV07-2. It has about 17,000 reads that match segment 4 but only about 150 reads which match other segments of H7N9.

The H7N9 reference sequence comes from a sample collected from a human patient in China in 2013, even though H7N9 samples from humans are otherwise fairly rare. When I aligned the reads of WIV07-2 against the refseq, I got an error rate of about 0.3% for reads that aligned against segment 4 (HA) and 0.3% for segment 8, but I got an error rate of 1.6-3.5% for the other segments (and there were only 4 reads which aligned against segment 8 so the low error rate may have been due to chance). So I thought that maybe the other segments come from a different source than segment 4:

brew install seqkit bowtie2 samtools gnu-sed
curl ftp://ftp.ncbi.nlm.nih.gov/entrez/entrezdirect/install-edirect.sh|sh

curl "https://www.ebi.ac.uk/ena/portal/api/filereport?accession=SRR11092059&result=read_run&fields=fastq_ftp"|sed 1d|cut -f1|tr \; \\n|sed s,^,ftp://,|xargs wget

esearch -db nuccore -query '(h7n9[organism] OR wuhan-hu-1) AND refseq[filter]'|efetch -format fasta|seqkit replace -isp 'a{5,}$'>h7n9sars2.fa

bowtie2-build h7n9sars2.fa{,}
bowtie2 -p4 --no-unal --local -x h7n9sars2.fa -1 SRR11092059_1.fastq.gz -2 SRR11092059_2.fastq.gz|samtools sort -@3 ->SRR11092059.local.bam

x=SRR11092059.local.bam;samtools coverage $x|awk \$4|cut -f1,3-6|(gsed -u '1s/$/\terr%\tname/;q';sort -rnk3|awk -F\\t -v OFS=\\t 'NR==FNR{a[$1]=$2;next}{print$0,sprintf("%.2f",a[$1])}' <(samtools view $x|awk -F\\t '{x=$3;n[x]++;len[x]+=length($10);sub(/.*NM:i:/,"");mis[x]+=$1}END{for(i in n)print i"\t"100*mis[i]/len[i]}') -|awk -F\\t 'NR==FNR{a[$1]=$2;next}{print$0"\t"a[$1]}' <(seqkit seq -n h7n9sars2.fa|gsed 's/ /\t/;s/,.*//') -)|column -ts$'\t'
#rname       endpos  numreads  covbases  coverage  err%  name
NC_026425.1  1708    17346     1685      98.6534   0.31  Influenza A virus (A/Shanghai/02/2013(H7N9)) segment 4 hemagglutinin (HA) gene
NC_045512.2  29870   5214      29843     99.9096   0.22  Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1
NC_026422.1  2280    107       2201      96.5351   3.29  Influenza A virus (A/Shanghai/02/2013(H7N9)) segment 1 polymerase PB2 (PB2) gene
NC_026427.1  980     27        543       55.4082   2.57  Influenza A virus (A/Shanghai/02/2013(H7N9)) segment 7 matrix protein 2 (M2) and matrix protein 1 (M1) genes
NC_026423.1  2297    10        671       29.212    3.47  Influenza A virus (A/Shanghai/02/2013(H7N9)) segment 2 polymerase PB1 (PB1) and PB1-F2 protein (PB1-F2) genes
NC_026428.1  841     4         140       16.6468   0.33  Influenza A virus (A/Shanghai/02/2013(H7N9)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes
NC_026426.1  1499    4         349       23.2822   2.00  Influenza A virus (A/Shanghai/02/2013(H7N9)) segment 5 nucleocapsid protein (NP) gene
NC_026424.1  2176    2         207       9.51287   1.67  Influenza A virus (A/Shanghai/02/2013(H7N9)) segment 3 polymerase PA (PA) and PA-X protein (PA-X) genes

Next I tried aligning the WIV07-2 reads against all H7N9 sequences from the NCBI's influenza virus database: https://www.ncbi.nlm.nih.gov/genomes/FLU/Database/nph-select.cgi. The 5 samples with the highest number of aligned reads for segment 4 were all from the year 2013. Out of a total of 750 sequences for segment 4 in my FASTA file, I got the highest number of aligned reads for A/Shanghai/02/2013, which is the H7N9 refseq:

#rname    endpos  numreads  covbases  coverage  err%   name
KF021597  1708    621       1685      98.6534   0.34   A/Shanghai/02/2013;4;China;2013;03;05;Human
CY146908  1683    603       1674      99.4652   0.32   A/chicken/Guangdong/SD641/2013;4;China;2013;05;03;Avian
KJ395948  1683    600       1594      94.7118   0.26   A/chicken/Guangdong/G2/2013;4;China;2013;05;05;Avian
KP413700  1683    578       879       52.2282   0.26   A/chicken/Dongguan/4195/2013;4;China;2013;12;19;Avian
KM879322  1683    325       1505      89.4236   0.28   A/chicken/Zhejiang/DTID-ZJU06/2013;4;China;2013;12;;Avian

However segment 1 got most aligned reads against samples from 2017 (top 5 samples shown):

#rname    endpos  numreads  covbases  coverage  err%   name
MG575543  2280    50        1866      81.8421   1.69   A/chicken/Anhui/AH395/2017;1;China;2017;03;06;Avian
KY621539  2341    8         279       11.918    1.08   A/Qingyuan/GIRD01/2017;1;China;2017;01;14;Human
MF630106  2280    6         254       11.1404   1.00   A/chicken/Guangdong/SD027/2017;1;China;2017;01;18;Avian
KY643838  2340    6         484       20.6838   1.33   A/Guangdong/SP440/2017;1;China;2017;01;04;Human
MF630458  2280    4         248       10.8772   3.67   A/duck/Hunan/S40506/2015;1;China;2015;11;16;Avian

Segment 7 also seems to match newer samples from around the year 2017:

#rname    endpos  numreads  covbases  coverage  err%  name
MW100646  1027    4         247       24.0506   1.50  A/chicken/Hunan/5.24_YYGK49P2-OC/2017;7;China;2017;05;24;Avian
MZ803120  1000    2         227       22.7      0.00  A/mallard/South Korea/20X-20/2021;7;South Korea;2021;01;06;Avian
MW265394  982     2         160       16.2933   1.00  A/chicken/Shanxi/SX0256/2019;7;China;2019;01;10;Avian
MW109507  1027    2         125       12.1714   0.67  A/environment/Jiangxi/2.06_SRGFYF005-E/2017;7;China;2017;02;06;Environment
MW109475  982     2         226       23.0143   1.00  A/environment/Jiangxi/1.11_NCDZT98F2-E/2017;7;China;2017;01;11;Environment

So it could be that the HA plasmid was designed based on the refseq strain from 2013, but the full virus came from a newer strain of H7N9.

Steve Massey: Is SARS-CoV-2 phylogenetically closer to RaTG13 or BANAL-52?

Steve Massey has been saying that SARS 2 is phylogenetically closer to RaTG13 than to BANAL-52 because it groups together with RaTG13 in maximum likelihood trees: [https://x.com/stevenemassey/status/1494076835902234627]

However the same thing can even happen in a distance-based tree. The tree below is based on a percentage distance of the whole genome so that positions where either sequence has a gap are not considered. I used the complete linkage method where the distance between two branches is the distance between the furthest nodes within the branches, so that for example the distance between SARS2 and the branch that contains the three BANAL viruses is the distance between SARS2 and the BANAL virus which is the furthest from SARS2, which happens to be BANAL-236. In my tree first BANAL-103 is joined with BANAL-236, and then their combined branch is joined with BANAL-52. And after that Wuhan-Hu-1 ends up being closer to RaTG13 than to the branch of the three BANAL viruses, so Wuhan-Hu-1 joins RaTG13 earlier:

The branching pattern remained the same even when I changed the linkage method from complete to ward.D2. But when I removed BANAL-236 and BANAL-103 from the tree, then Wuhan-Hu-1 joined with BANAL-52 before RaTG13:

brew install iqtree mafft seqkit xz
wget sars2.net/f/sarbe.{pid,fa.xz};xz -d sarbe.fa.xz

# thin out a TSV percentage identity matrix to remove sequences with over n% identity to any previous sequence (default 99%)
thin()(awk -F\\t 'NR>1{for(i=2;i<NR;i++)if($i>x)next;print$1}' x="${1-99}" "${@:2}")

# matrix sort grep (sort TSV matrix by column that matches regex and print the column along with the first column)
masog()(awk -F\\t 'NR==1{for(i=2;i<=NF;i++)if($i~x)break;next}{print$i,$1}' x="$1" "${2--}"|sort -n)

# short name
shorn()(sed -E $'s/(,| surface| ORF1| orf1| genomic sequence).*//;s/Severe acute respiratory syndrome/SARS/;s/ isolate / /')
shorn2()(shorn|sed 's/ RNA$//;s/>.* />/')

# select sequences with at least 92% identity to Wuhan-Hu-1; omit sequences with over 99.9% identity to another sequence
masog Hu-1<sarbe.pid|awk '$1>=90{print$2}'|sort|comm -12 <(thin 99.9 sarbe.pid|cut -d\  -f1|sort) -|seqkit grep -f- sarbe.fa|shorn2|mafft --thread 4 --quiet ->iqtree.fa
seqkit grep -nvrp '20-(103|236)' iqtree.fa>iqtree2.fa

curl -Ls sars2.net/f/pid.cpp>pid.cpp;g++ pid.cpp -O3 -o pid
pid<iqtree.fa>iqtree.pid;pid<iqtree2.fa>iqtree2.pid
t=100-read.table("iqtree.pid",row.names=1,header=T,sep="\t",check.names=F)
m=as.matrix(t)

hc=hclust(as.dist(m)) # complete linkage
# hc=hclust(as.dist(t),"ward.D2") # Ward linkage
hc=as.hclust(reorder(as.dendrogram(hc),cmdscale(m)[,1]))

pheatmap::pheatmap(m,filename="1.png",display_numbers=round(m),legend=F,
  clustering_callback=\(...)hc,
  cellwidth=17,cellheight=17,fontsize=9,fontsize_number=8,border_color=NA,
  number_color=ifelse(t>max(t)*.45&!is.na(t),"white","black")[hc$order,hc$order],
  sapply(255:0,\(i)rgb(i,i,i,maxColorValue=255)))

In a world where more RaTG13-like viruses would be published, RaTG13 might join other RaTG13-like viruses earlier than SARS2. So then if the other RaTG13-like viruses would be further from SARS2 than RaTG13 is, it would increase the distance between SARS2 and the branch of RaTG13-like viruses, so then SARS2 might join the BANAL branch before the branch of RaTG13-like viruses. So therefore which branch is joined by SARS2 first might depend on which branch has more published sequences.

In the output below I used IQTree to generate maximum likelihood trees. On the left side where I included all 5 BANAL viruses, Wuhan-Hu-1 is grouped together with RaTG13. But on the right side where I again removed BANAL-103 and BANAL-236, Wuhan-Hu-1 is grouped together with BANAL-52 and not RaTG13. So a similar phenomenon I demonstrated above using a distance-based tree can also occur in a maximum likelihood tree:

$ iqtree -nt AUTO -s iqtree.fa;iqtree -nt AUTO -s iqtree2.fa
[...]
$ paste <(echo $'--- All five BANAL viruses included ---\n';sed '1,/^NOTE:/d' iqtree.fa.iqtree|sed 1d|sed '/^$/q') <(echo $'--- BANAL-103 and BANAL-236 excluded ---\n';sed '1,/^NOTE:/d' iqtree2.fa.iqtree|sed 1d|sed '/^$/q')|column -ts$'\t'
--- All five BANAL viruses included ---                                   --- BANAL-103 and BANAL-236 excluded ---
+**Ra22QT137                                                              +**Ra22QT137
|                                                                         |
+**Ra22QT106                                                              +**Ra22QT106
|                                                                         |
|  +--Ra22QT135                                                           |  +--Ra22QT135
+**|                                                                      +**|
   |  +--Ra22QT77                                                            |  +--Ra22QT77
   +--|                                                                      +--|
      |                           +--Wuhan-Hu-1                                 |                       +--Wuhan-Hu-1
      |                        +--|                                             |                    +--|
      |                        |  +-----RaTG13                                  |                    |  +--BANAL-20-52_Laos_2020
      |                     +--|                                                |                 +--|
      |                     |  +--BANAL-20-52_Laos_2020                         |                 |  +-----RaTG13
      |                  +--|                                                   |              +--|
      |                  |  |  +--BANAL-20-236_Laos_2020                        |              |  |      +--bat_Yunnan_RpYN06_2020
      |                  |  +--|                                                |              |  |  +---|
      |                  |     +--BANAL-20-103_Laos_2020                        |              |  |  |   |               +--PrC31
      |               +--|                                                      |              |  |  |   +---------------|
      |               |  |      +--bat_Yunnan_RpYN06_2020                       |              |  |  |                   |   +--YN2021
      |               |  |  +---|                                               |              |  |  |                   +---|
      |               |  |  |   |              +--PrC31                         |              |  |  |                       |        +--Rp22DB159
      |               |  |  |   +--------------|                                |              |  |  |                       +--------|
      |               |  |  |                  |   +--YN2021                    |              |  |  |                                +--BtSY2
      |               |  |  |                  +---|                            |              |  +--|
      |               |  |  |                      |        +--Rp22DB159        |              |     |        +--BANAL-20-247_Laos_2020
      |               |  |  |                      +--------|                   |              |     |    +---|
      |               |  |  |                               +--BtSY2            |              |     |    |   +--BANAL-20-116_Laos_2020
      |               |  +--|                                                   |              |     +----|
      |               |     |       +--BANAL-20-247_Laos_2020                   |              |          |            +--RacCS271
      |               |     |    +--|                                           |              |          +------------|
      |               |     |    |  +--BANAL-20-116_Laos_2020                   |              |                       |  +--RacCS253
      |               |     +----|                                              |              |                       +--|
      |               |          |            +--RacCS271                       |              |                          +--RacCS203
      |               |          +------------|                                 +--------------|
      |               |                       |  +--RacCS253                                   |                         +--GD_P79-9_2019
      |               |                       +--|                                             +-------------------------|
      |               |                          +--RacCS203                                                             +--MP789
      +---------------|
                      |                       +--GD_P79-9_2019
                      +-----------------------|
                                              +--MP789

Ryan Hisner: Is the G nucleotide overrepresented in insertions?

LongDesertTrain posted this tweet: [https://x.com/LongDesertTrain/status/1799204384628162903]

In a nearly complete collection of GISAID submissions with a collection date in 2020, there were a total of 10,005 unique insertions. However G was the least common nucleotide within in the insertions, even though C is less common than G in Wuhan-Hu-1:

$ curl -Ls sars2.net/f/gisaid2020.tsv.xz|xz -dc>gisaid2020.tsv
$ cut -f14 gisaid2020.tsv|tr , \\n|awk '!a[$0]++'|cut -d: -f2|grep -o '[ACGT]'|sort|uniq -c|sort
  26495 G
  28057 C
  39400 T
  43419 A
$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=MN908947'>sars2.fa
$ seqkit seq -s sars2.fa|grep -o .|sort|uniq -c|sort
   5492 C
   5863 G
   8954 A
   9594 T

Even when I only looked at insertions which occurred in at least 10 submissions, G was still the least common:

$ cut -f14 gisaid2020.tsv|sed 1d|tr , \\n|awk '++a[$0]==10'|grep -o '[ACGT]'|sort|uniq -c|sort
    283 G
    304 C
    505 T
    544 A

Steve Massey: Is the RaTG13 sample from a female bat?

Steve Massey posted a Twitter thread where he suggested that the RaTG13 sample may have come from a vaginal plug of a female bat that contained stored sperm. [https://x.com/stevenemassey/status/1805641989049794826] He aligned the reads of RaTG13 and RaTG15-related runs published at CNCB against the genes of Rhinolophus sinicus, he calculated a z-scores for the number of reads that aligned against each gene, and he characterized the functions of the genes with the highest z-scores by using a web-based utility called g:GOSt that is part of g:Profiler.

You can try out the utility if you copy the names of the thousand genes with the highest z-score for RaTG13 from here: https://docs.google.com/spreadsheets/d/1dH2hom5HJdY0ZfCaKmDSJy910WlubXvw. Then paste the names of the genes here: https://biit.cs.ut.ee/gprofiler/gost. It shows that for example the cellular component with the lowest p-value is "sperm flagellum":

However RaTG13 is listed as a sample from a male bat at GISAID. [https://x.com/stevenemassey/status/1805646768505295104]

In order to guess the sex of the sample, I tried aligning all reads of RaTG13 against a Y-chromosome sequence of Rhinolophus affinis: https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_040057535.1/. However about half of all reads aligned against the Y-chromosome even though the Y-chromosome only makes up about 0.2% of the total length of the genome, so clearly most of the aligned reads didn't actually come from the Y-chromosome. I could've probably gotten rid of some of the spurious matches by using more strict alignment criteria or by doing global instead of local alignment. However I simply decided to align the reads against every chromosome of Rhinolophus affinis instead, and I counted what percentage of reads aligned against the Y-chromosome out of all chromosomes.

I downloaded the first million reads of RaTG13, the RaTG15-related runs from CNCB, the WIV bat anal swab runs from February 2020, and a couple of other R. affinis runs. [https://www.ncbi.nlm.nih.gov/sra/?term=SRR11085797, https://ngdc.cncb.ac.cn/gsa/browse/CRA004339, https://www.ncbi.nlm.nih.gov/bioproject/PRJNA606159, https://www.ncbi.nlm.nih.gov/sra/?term=rhinolophus+affinis+metagenome]

In a sample from a female bat that had some sperm cells mixed in, the percentage of Y-chromosome reads might be expected to be intermediate between a sample from a male bat and a sample from a female bat. However RaTG13 ended up getting one of the highest percentages of Y-chromosome reads, which I think makes it less likely that the sample was actually from a female bat. Here the second column shows the number of reads that aligned against the y-chromosome, and the third column shows the number of reads that aligned against all chromosomes, and the first chromosome shows the ratio between the second and third columns as a percentage:

$ datasets download genome accession GCA_040057535.1 --include genome
[...]
$ unzip ncbi_dataset.zip
[...]
$ seqkit grep -nrvp contig ncbi_dataset/*/*/*.fna>raffinis.fa
$ mkdir ratg15;parallel -j10 curl -Ls https://download.cncb.ac.cn/gsa/CRA004339/{}/{}_f1.fq.gz\|seqkit head -n1000000 -o ratg15/{}.fastq.gz ::: CRR29060{0..7}
$ printf %s\\n SRR110857{97,33..41} SRR1206284{4,5} SRR22936{563,575,577,578,715,806}|parallel -j20 fastq-dump -O wivswab -X 1000000 --gzip {}
[...]
$ for f in {wivswab,ratg15}/*gz;do minimap2 --secondary=no -a --sam-hit-only raffinis.fa $f|samtools view -b ->${f%fastq.gz}bam;done
[...]
$ for f in {wivswab,ratg15}/*bam;do samtools view -F2048 -q40 $f|awk '$3=="CM078718.1"{y++}END{print y/NR*100,y,NR,x}' x=${f##*/};done|sort -n|column -t
0.0000  0     10021   SRR11085735 # 2020 Hipposideros pomona
0.0000  0     10985   SRR11085740 # 2020 Miniopterus pusillus
0.0000  0     117541  SRR11085738 # 2020 Pipistrellus abramus
0.0000  0     126057  SRR11085739 # 2020 Tylonycteris pachypus
0.0000  0     127436  SRR11085734 # 2020 Miniopterus schreibersii
0.0000  0     259098  SRR11085733 # 2020 Hipposideros larvatus
0.0000  0     28214   SRR11085741 # 2020 Rousettus aegyptiacus
0.0000  0     77898   SRR11085736 # 2020 Rhinolophus affinis
0.0000  0     92441   SRR11085737 # 2020 Scotophilus kuhlii
0.0014  2     147779  SRR22936563 # 2023 R. affinis rectum
0.0040  30    745986  CRR290604   # CNCB Rs7921
0.0063  54    857367  CRR290602   # CNCB Rs7907
0.0121  104   856451  SRR22936806 # 2023 R. affinis rectum
0.0182  151   831478  SRR22936577 # 2023 R. affinis rectum
0.0288  250   868272  SRR22936578 # 2023 R. affinis rectum
0.0327  248   758136  SRR12062845 # male R. affinis
0.0364  290   797144  SRR12062844 # male R. affinis
0.0685  606   884761  SRR22936575 # 2023 R. affinis rectum
0.0808  655   810586  SRR22936715 # 2023 R. affinis rectum
0.0959  858   895039  CRR290603   # CNCB RaTG15
0.2698  2258  836945  CRR290600   # CNCB Rs7896
0.3205  957   298629  SRR11085797 # RaTG13
0.3283  2712  826136  CRR290605   # CNCB Rs7924
0.3584  2908  811415  CRR290606   # CNCB Rs7931
0.3661  2984  815123  CRR290601   # CNCB Rs7905
0.3990  3275  820898  CRR290607   # CNCB Rs7952

In the code above the --secondary=no flag disables secondary alignments, but it doesn't disable supplementary alignments which get later filtered out by -F 2048.

A binary for the datasets command can be downloaded from here: https://www.ncbi.nlm.nih.gov/datasets/docs/v2/download-and-install/.

The 2023 SADS-CoV outbreak had a laboratory origin

In 2024 Alexandre Hassanin and coauthors published a paper where they described a new SADS-related bat virus from Vietnam, and they compared it to earlier Chinese SADS-related bat viruses and SADS. [https://pmc.ncbi.nlm.nih.gov/articles/PMC11281452/]

They pointed out that several of the Chinese viruses displayed unnatural recombination patterns which may have been inauthentic (even though the authors seem to have played it safe by suggesting it was the result of unintentional mistakes and not deliberate fraud):

By examining SWB bipartitions showing strong support in these two regions, we found that two Rhinacovirus genomes sequenced from R. pusillus are problematic, RpGX16-Q222 and RpGX17-Q225 (GenBank accessions OQ175208 and OQ175209, respectively [9]): they appeared to be closely related to all SADS-CoVs in positions 14,601-14,900 (SWB400 bipartition n°836) and to all SADS-CoVs except CH/FJWT/2018 in positions 21,501-21,900 (SWB400 bipartition n°571) (Figure S6); by examining the alignment, we found that they are identical to most SADS-CoVs in positions 14,503-15,555, whereas in positions 21,265-21,959, they are identical to SADS-CoV CHN-GD/2017 and very similar to other SADS-CoVs (99.7% of identity) (Figure 6A). By contrast, both RpGX16-Q222 and RpGX17-Q225 appeared to be very divergent from other members of the R. pusillus group in these two regions: between 14% and 15% in the first region and between 27% and 29% in the second region. If we consider RpGX16-Q222 and RpGX17-Q225 genomes to be entirely authentic, we have to admit that a SADS-CoV strain may have recombined with a bat rhinacovirus of the R. pusillus group. Such a scenario seems very unlikely as it implies that either pigs or R. pusillus bats were coinfected by SADS-CoV and a rhinacovirus of the R. pusillus group. As an alternative, we rather suggest that the genomes of RpGX16-Q222 and RpGX17-Q225 are chimeric: although most parts of their genomes are authentic sequences, two regions were mistakenly assembled with SADS-CoV sequences (Figure 6A).

[...]

Our analyses revealed that RaYN20-Q207 (GenBank accession: OQ175197 [9]) is another problematic genome. Whereas most parts of its genome were found to support a grouping with RaYN20-Q216 (GRPS = 40%; Figure 3), three fragments of ORF1ab and one fragment of the Spike gene rather provided support for a grouping with RaGD17-Q208 (GRPS = 28%; Figure 5). By examining the alignment, we found a perfect identity between RaYN20-Q207 and RaGD17-Q208 in three genomic regions, i.e., positions 1-1787 (length: 1787 nt), 3820-7943 (length: 4124 nt), and 19,806-20,198 (length: 393 nt), whereas adjacent genomic regions showed much more nucleotide divergence (Figure S7). If these two sequences are authentic, our interpretation is that these three fragments were inherited in the ancestor of RaYN20-Q207 by genomic recombination with a parental virus identical or closely related to RaGD17-Q208. However, this hypothesis seems unlikely, as RaGD17-Q208 was sampled in 2017 in Guangdong, whereas RaYN20-Q207 was collected in 2020 in Yunnan. As an alternative hypothesis, we propose that RaYN20-Q207 is a chimeric genome containing three misassembled fragments from RaGD17-Q208.

[...]

The 5'-end of CHN-GD/2017 (positions 1-1787) was found to be identical to that of RsHKU2 (GenBank accession: NC_009988) (Figure 6A), whereas these two viruses were collected from a neonatal piglet with acute diarrhoea in 2017 and from a R. sinicus in 2006, respectively [12,27]. Since 11 years of evolution without any mutations seems inconceivable, we conclude that the 5'-end of CHN-GD/2017 is not authentic as it was completed with that of the RsHKU2 genome, which was sequenced and published several years before.

[...]

Although these results may suggest that Ra162140 was a direct parental progenitor of SADS-CoV CH/FJWT/2018, we consider this hypothesis to be unlikely since Ra162140 was collected between 2013 and 2016 from an R. affinis of Guangdong Province, China [3,28], whereas SADS-CoV CH/FJWT/2018 was collected in 2018 from a diarrhoeal piglet of Fujian Province, China [5]. After at least two years of evolution and a host species jump from bats to pigs, we indeed expect to find a few mutations separating SADS-CoV CH/FJWT/2018 from Ra162140 in the two problematic regions of 1890 and 703 nt, respectively. As an alternative hypothesis, we, therefore, suggest that SADS-CoV CH/FJWT/2018 could be a chimeric genome: although most parts represent an authentic SADS-CoV sequence, two regions were potentially completed with Ra162140 sequences.

[...]

According to the hypothesis involving recombination, CH/FJWT/2018 and Guangxi/2021 genomes are considered to be fully authentic; based on the three genomic fragments A, B and B' shown in Figure S6, we can propose that at least three recombination events occurred in pigs and involved the main SADS-CoV lineage (the one containing all strains currently sequenced except CH/FJWT/2018 and Guangxi/2021) and a second swine lineage identical or more closely related to the bat rhinacovirus Ra162140. According to the hypothesis involving human errors, CH/FJWT/2018 and Guangxi/2021 genomes are considered to be artificially chimeric; the fragment(s) of bat rhinacoviruses found in their genomes were not authentic; they were integrated into the sequences following human errors, which could be due to carry-over contamination during PCRs, incorrect pooling of pig and bat samples in the same NGS library, or bioinformatic error (e.g., the consensus sequence was misassembled by calling a bat reference sequence when there was no coverage). To provide definitive conclusions on the authenticity of their genomes, we consider that [5,7] should deposit their metagenomic data and Sanger electropherograms in international databases and publish the primer sets they used for PCR amplification and sequencing. In the absence of these data, these two problematic SADS-CoV genomes should be considered doubtful and excluded from future studies.

Hassanin et al. also wrote:

Recently, [33] reported that SADS-CoV re-emerged in June 2023 in Henan Province (central China) with an outbreak that caused the death of about 400 piglets. The genome of the new SADS-CoV strain (HNNY/2023; GenBank accession: PP069800 [33]) shared 99.92% of nucleotide identity with the first SADS-CoVs identified in Guangdong in 2017 [3]. Such a high nucleotide conservation means that all SADS-CoV strains originated from the same source, i.e., farmed pigs contaminated by bats in northern Guangdong, and that the virus has been circulating silently in domestic pigs for at least seven years, spreading from farm to farm in Guangdong between 2016 and 2019 [1,2,3,4], and then in the west in Guangxi in 2021 [7], and in the north in Jiangxi and Fujian in 2018 [5,10], and more recently in Henan in 2023 [33].

The new SADS-CoV sequence HNNY/2023 has an assembly error at the 5' end where bases 1-54 are identical to bases 3193-3246:

$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=PP069800'>newsads.fa
$ seqkit subseq -r1:54 newsads.fa|seqkit locate -f- newsads.fa |cut -f1,4-6|column -t
seqID       strand  start  end
PP069800.1  +       1      54
PP069800.1  +       3193   3246

When I excluded the poly(A) tail and the region with the assembly error in the 5' UTR, HNNY/2023 had 10 bases different from SADS-CoV/CN/GDWT/2017, 9 bases different from SADS-CoV/GDWT-P7 (7th passage), and 8 bases different from SADS-CoV/GDWT-P18 (18th passage, with a collection date in March 2018):

# top 250 BLAST matches in 2025 to new SADS sequence from 2023
curl -Ls sars2.net/f/sads25.fa.xz|xz -dc>sads25.fa

# nucleotide changes from first sequence in FASTA file to each other sequence
dist1u()(seqkit fx2tab "$@"|awk -F\\t 'NR==1{split($2,a,"");l=length(a);next}{split($2,b,"");d=0;for(i=1;i<=l;i++)if(a[i]!=b[i])d++;print d,$1}')

# closest neighbors of new 2023 SADS sequence with ends of UTRs excluded
seqkit subseq -r 59:34670 sads25.fa|seqkit fx2tab|sed 1p|seqkit tab2fx|dist1u|sort -n|head -n16|cut -d\| -f-3|sed 's/Swine acute diarrhea syndrome coronavirus/SADS-CoV/;s/ isolate / /'|sed 's/ /|/;s/ /|/'|(echo 'muts|accession|name|creation|collection';cat)|tr \| \\t|csvtk -t pretty -s\ |sed 2d
muts accession  name                                       creation   collection
0    PP069800.1 SADS-CoV strain SADS-CoV/HNNY/2023         2024-03-27 2023-06-20
8    MK994935.1 SADS-CoV SADS-CoV/GDWT-P18                 2020-03-03 2018-03    # passage 18 of cultured strain
9    MK994934.1 SADS-CoV SADS-CoV/GDWT-P7                  2020-03-03 2017       # passage 7 of cultured strain
10   MG557844.1 SADS-CoV SADS-CoV/CN/GDWT/2017             2018-03-18 2017-04    # original pig sample from 2017
10   MT039231.1 Mutant SADS-CoV strain icSADS              2020-06-15
12   MF769420.1 SADS-CoV 246                               2018-03-18 2017
13   MF769424.1 SADS-CoV 182                               2018-03-18 2017
14   MF094683.1 SADS-CoV FarmC                             2018-03-18
14   MW727454.1 Porcine enteric alphacoronavirus GDZQ-2018 2022-03-01 2018-09-01
15   MF094682.1 SADS-CoV FarmB                             2018-03-18
15   MF769417.1 SADS-CoV 31                                2018-03-18 2017
15   MG605091.1 SADS-CoV SADS-CoV/CN/GDLS/2017             2018-09-16 2016-08-09
16   MF094681.1 SADS-CoV FarmA                             2018-03-18
16   MF769428.1 SADS-CoV 53                                2018-03-18 2017
17   MF769419.1 SADS-CoV 197                               2018-03-18 2017
17   MF769441.1 SADS-CoV 82                                2018-03-18 2017

So was there convergent evolution in cell culture and pig farms, where the cultured strain gradually evolved closer to the strain that was detected on pig farms in 2023? There should normally be much more than 8-10 mutations over a period of about 5-6 years.

The SADS-CoV/HNNY/2023 sequence was described in a paper titled "Re-emergence of severe acute diarrhea syndrome coronavirus (SADS-CoV) in Henan, central China, 2023". The paper is behind a paywall, but the parts of the paper that are freely visible seem to have suggested the virus developed naturally out of a virus that had been circulating on pig farms since the 2017 outbreak: [https://www.sciencedirect.com/science/article/abs/pii/S0378113524000713]

Severe acute diarrhea syndrome coronavirus (SADS-CoV) was first detected in Guangdong province of China in 2017. And yet from May 2021 to Jun 2023, there were no SADS-CoV outbreaks. In this study, we reported the recent outbreak of SADS-CoV in China on Jun 2023. Phylogenetic analysis showed the novel strain was derived from the ongoing transmission and evolution of SADS-CoV in China, rather than a separate cross-species transmission from bats. Also, the novel strain was found to participate in a recombant event as a minor parent and a missing base in the genome was discovered indicating an novel evolutionary pathway.

The "missing base" probably refers to a single gap at position 26,714 in my alignment here, which results in a premature termination of the last ORF. This shows the new sample from 2023 on the left and the 18th passage of the 2017 sample on the right:

$ R -e 'if(!require("BiocManager"))install.packages("BiocManager");BiocManager::install("Biostrings")'
$ aldi2(){ cat "$@">/tmp/aldi;Rscript --no-init-file -e 'm=t(as.matrix(Biostrings::readAAStringSet("/tmp/aldi")));diff=which(rowSums(m!=m[,1])>0);split(diff,cumsum(diff(c(-Inf,diff))!=1))|>sapply(\(x)c(if(length(x)==1)x else paste0(x[1],"-",tail(x,1)),apply(m[x,,drop=F],2,paste,collapse="")))|>t()|>write.table(quote=F,sep=";",row.names=F)';}
$ seqkit grep -nrp HNNY/2023,GDWT-P18 sads25.fa|mafft --quiet --thread 4 -|cut -d\| -f-3|aldi2
;PP069800.1 Swine acute diarrhea syndrome coronavirus strain SADS-CoV/HNNY/2023|2024-03-27|2023-06-20;MK994935.1 Swine acute diarrhea syndrome coronavirus isolate SADS-CoV/GDWT-P18|2020-03-03|2018-03
1-3;--g;aca
5;t;g
7;a;g
9-55;atcattgatactgctcttactgcaactaagtcatactacaatgttcc;-----------------------------------------------
6649;c;t
10784;a;c
20879;a;g
21395;a;g
23506;c;a
24712;c;t
26714;-;t
26997;t;c
27213-27263;aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa;---------------------------------------------------
Width
Font size
Line height