Richard Fleming is a fraud - sars2.net

First published 2025-01-23 UTC, last modified 2026-03-28 UTC

Contents

Fleming's history of lies and fraud

Research by Cheshire and LogarithmicDis

See these pages:

Fake PhD diploma in physics

Fleming wrote: "Yes, @kalashnikity I received my PhD two days after my HS diploma. That was the requirement from the work begun in 1968 when our group, following the MK Ultra group, was initiated. I owe much to many including respect and confidentiality of our work." [https://x.com/Doctor_I_am_The/status/1876680552952004630, https://archive.is/IZdz7]

When someone asked Fleming to post his PhD thesis to show it wasn't fake, Fleming replied "Q-clearance". [https://x.com/Doctor_I_am_The/status/1876722383400083499] Fleming also said: "As far as my research for the thesis, this was classified as Q-clearance in 1974. I have reached out to Trump and others to work with him using this research." [https://x.com/Doctor_I_am_The/status/1882153774636028052] And later Fleming said: "I myself agreed to make my doctorate research Q-clearance because I could not envision humanity using it for the peaceful purposes I had intended it to be used for. I could only envision it being used for destructive purposes." [https://x.com/Doctor_I_am_The/status/1893677446081269778]

The Twitter user LogarithmicDis found many problems with Fleming's diploma: [https://x.com/LogarithmicDis/status/1882133468500660348]

On his website he has posted his "highly unusual" PhD diploma that he started on supposedly at age 12, if you subtract his birth year (posted online by him) from a 1968 matriculating date = 12 years old.

But the diploma has MANY problems.

First, the doctor is a convicted felon and was sentenced for his criminal acts and debarred by the FDA.

https://archives.fbi.gov/archives/omaha/press-releases/2009/om082009.htm

So his honesty isn't exactly batting a thousand here. Upon closer look at his CV posted on his website:

And closer look at the unusual PhD diploma with contrast adjusted, we see a copy and paste left hand signature rectangle and very unusual seals.

But there are 12 total problems with this "diploma" that I see:

1. There is no such thing as "The State Universities of Iowa".

University of Iowa was in fact called "State University of Iowa".

Singular, not plural.

https://iowaregents.edu/the-board/regents-history

2. The copy & paste left hand signatures (contrast adj).

3. The president of the Board of Regents was Mary Peterson in 1974. So wrong name here.

4. The proper title is President, Board of Regents (not Board of Education, a term that ceased in 1955).

https://iowaregents.edu/the-board/regents-history

5. The seals appear to not be original to the background

6. LT and RT seals do not fade w/the document (along w/the square patch on left and e-signatures in right, addressed later).

7. The middle seal appears curved and uneven, like a poor patch job.

8. Right seal is what?

9. Two electronic signatures are exactly the same font and uncharacteristic of 1974.

10. Weird fine print at bottom with misspelling.

11. Executive order reference to JFK is strange on a diploma. Here are JFK's EOs:

https://en.wikipedia.org/wiki/List_of_executive_actions_by_John_F%2e_Kennedy

12. UNI does not confer PhD degrees. It was formerly a teachers college and confers only EdD degrees.

Here's his CV from @Doctor_I_am_The federal criminal court case in 2009.

He failed to update it.

Certification Board in Nuclear Cardiology reveals no certifications currently.

https://apca.org/certifications-examinations/cbnc-and-cbcct/cbnc/

ASNC says expired in 2002.

I verified the diploma was fake with the regent universities. I actually called (like that was necessary? lol 😂)

[...]

And the ridiculous statement at the bottom of Fleming's confirmed fake degree is a complete joke.

Here are JFK's EO's that day.

https://federalregister.gov/presidential-documents/executive-orders/john-f-kennedy/1963

The line at the bottom of the diploma says: "This Doctorate is issued for the recipient's work on plasma and positrons pursuant to Executive Order APP#43 issued January 29, 1963 by John Fitzgerald Kennedy, President of the Unisted [sic] States of America." But the list of executive orders issued by JFK is public, and it doesn't include any order number "APP#43".

I tried to check if the diploma featured fonts which had not yet been published in 1974, but I believe the two fonts I was able to identify had both been published before 1974 (even though it's possible that Fleming would have used newer near-identical variants of the old fonts I identified, because there's newer copycat versions of both fonts.)

The signatures of Francis F Chen and CD Anderson seem to have been written in some version of the Brush Script font, which was designed in 1942:

At first I thought the blackletter font in the diploma was Monotype Old English Text which was only published in 1990. [https://www.myfonts.com/collections/old-english-text-font-monotype-imaging] However Monotype Old English Text is a clone of an older font called Cloister Back that was designed around 1904, and based on the angle of the upper left arm in the capital letter U, Fleming's font actually seems closer to Cloister Black than to Monotype Old English: [http://identifont.com/show?249]

When I linked to the thread by LogarithmicDis, Fleming told me: "This image of my doctoral diploma is clearly altered and you are either guilty of altering it or guilty of presenting an altered diploma. It's a new country. :-)". [https://x.com/Doctor_I_am_The/status/1882159478986170631] Fleming also told me: "This doctorate was manipulated by people on line. People who spend a lot of time manipulating images including published research." [https://x.com/Doctor_I_am_The/status/1882153774636028052] However I didn't find any way the images in the thread by LogarithmicDis were manipulated apart from the adjustment of contrast which she mentioned in her thread.

But perhaps Fleming was projecting his own sins onto his adversaries, because at some point after LogarithmicDis posted her thread, Fleming modified the image of his diploma on his website, so that he altered the background of the signatures on the left and the two seals in the middle to match the background of the rest of the paper: [https://www.flemingmethod.com/publications]

The old version of the image where the backgrounds don't match is still available at the Wayback Machine: [http://web.archive.org/web/20230206233241/https://www.flemingmethod.com/publications, https://archive.is/Z1Ja4]

When I asked Fleming about his PhD thesis, he told me to read his book "Are We the Next Endangered Species". [https://x.com/Doctor_I_am_The/status/1878458620402151869] I believe he wanted me to read the appendix of his book titled "Fleming Doctorate Research and Training". However I didn't find the book on Libgen or Anna's Archive, and it costs 27 USD on Amazon, but I don't want to pay that much for a single book chapter.

Twitter accounts ExperiencedStud and ImBodu

Fleming used to have a Twitter account called ExperiencedStud, where he advertised his work as an actor and he tried to get casted in adult films. There's no snapshots of the account at the Wayback Machine, but Cheshire managed to take these screenshots of the account: [https://x.com/Thatsregrettab1/status/1559607005848883200/photo/1]

I don't know if Fleming actually managed to appear in any adult movie, because one of his tweets from 2016 said: "I've been acting a couple years. Just started in porn a few weeks ago after people told me for years I'm a natural. Looking to be your talent". [https://x.com/Thatsregrettab1/status/1386706893788258313]

Fleming said that the account was hacked, and that when he was called an adult actor, it just meant that he was not a child actor: [https://x.com/Doctor_I_am_The/status/1386712519436349440, https://x.com/Doctor_I_am_The/status/1788273755619242277]

Fleming also claimed that the account was called "Experienced Student that got truncated and then hacked": [https://x.com/Doctor_I_am_The/status/1386723883647131658]

The truncation theory is actually somewhat plausible, because when you register a new account on Twitter, you are first asked to enter a display name, and then Twitter automatically suggests a username based on the display name, so that spaces are removed and the name is truncated to at most 15 characters, and "ExperiencedStud" happens to be 15 characters long. But why would Fleming not have edited the username manually?

However as evidence against Fleming's hacking theory, the court documents of the Fleming v. Sims case said: "According to Larry Sims, the parties first came into contact after Defendants placed a job posting on an adult entertainment job listing website. (See, e.g., ECF Nos. 90 at 1-2, 124 at 1, 188 at 1, 234 at 1, 244 at 1.) Plaintiff allegedly responded to the advertisement and represented himself as an adult film actor and model. (Id.)" [https://www.courtlistener.com/docket/6282193/247/fleming-v-sims/]

As an aside, the reason why Fleming said that Cheshire was connected with "criminal pedophiles" was because David Gorski's blog used to be hosted on a platform called ScienceBlogs, which was operated by a company called Seed Media Group that published a science magazine called Seed. Epstein had invested in Seed Media Group, and Ghislaine Maxwell was briefly on their board of directors in 2007-2008. But Gorski wrote that he didn't know at the time that Epstein or Ghislaine were connected to the blogging platform (and at the time they were not yet household names, so it's likely that Gorski wouldn't have even know who they were). [https://www.respectfulinsolence.com/2024/06/22/so-its-guilt-by-association-again-is-it/] And Cheshire doesn't even seem to be too closely connected to Gorski, because they have had only a few interactions on Twitter, even though Cheshire has often posted comments to Gorski's blog. [https://x.com/search?q=%28from%3AThatsregrettab1%20to%3Agorskon%29%20OR%20%28from%3Agorskon%20to%3AThatsregrettab1%29&f=live] But Epstein is connected to so many people that it's easy to find people who are only a few degrees separated from Epstein. For example one of the speakers on Fleming's Crimes Against Humanity Tour was Steve Kirsch, but the director of the Japanese branch of his company InfoSeek was Joi Ito, who was Epstein's go-to guy at MIT. On a list of Epstein's visits to MIT that shows the people who accompanied him on each visit, Joi Ito is the only person who accompanied Epstein on every visit. [https://twitter.com/JesseMatchey/status/1751716750079533447] Epstein hooked up Joi Ito with a 2 million USD donation from Bill Gates and a 4 million donation USD from Leon Black. [https://www.newyorker.com/news/news-desk/how-an-elite-university-research-center-concealed-its-relationship-with-jeffrey-epstein] MIT has a lecture hall named after Kirsch because he donated 3 million USD to MIT, but Bill Gates is a friend of Kirsch, and one time when Kirsch sent out a request to his friends to donate money to a charity in his home county, he got Bill Gates to donate 5 million USD to the charity. [http://skirsch.com/charity/philanthropy/UnitedWayDonation.htm] Epstein met Leon Black through "his connections through those close to the Rockefeller and Rothschild families", but Kirsch launched his COVID-19 Early Treatment Fund under the auspices of Rockefeller Philantropy Advisors, which even hosted the website of the fund. [https://www.cnbc.com/2019/09/09/jeffrey-epstein-got-bill-gates-meeting-after-aggressive-lobbying-campaign.html, http://web.archive.org/web/20200929142839/https://www.rockpa.org/project/covid-19-early-treatment-fund/] And as another example of an indirect connection between Fleming and Epstein, Fleming coauthored a paper with Kevin McCairn, who did many of his early appearances in alt media with George Webb's mini-me Addy Adds and George Webb's science teacher Paul Cottrell, but George Webb said that when he lived in New York in 2002-2003, he shared an apartment with a lady who worked as a caterer for Epstein's parties and who secretly videotaped the parties. [clot3.html#Kevin_McCairns_connection_to_Cottrell_Couey_Kulacz_and_Webb] (I'm not saying that either of Fleming's connections to Epstein is relevant, but I think Cheshire's connection to Epstein via Gorsky is even less likely to be relevant.)


Fleming's Twitter account used to be called MedicinesDarkK1 until October 2020. [https://x.com/search?q=medicinesdarkk1&f=live] After that he briefly changed his username to Lys_og_sannhet (which means "light and truth" in Norwegian) until he settled with his current username Doctor_I_am_The. [https://x.com/Thatsregrettab1/status/1331705114659229696] His old username was probably a reference to how Batman is called the Dark Knight: [https://x.com/Thatsregrettab1/status/1876688818805350811]

Fleming's IMDB profile has a photo where he poses as Batman and a video where he poses as Joker: [https://www.imdb.com/name/nm6222842/mediaviewer/rm57834240/, https://www.imdb.com/video/vi1525398297/]

There's an account with a Batman avatar called "ImBodu" (where the "Im" seems to match "I_Am" in the username of Fleming's main account). The ImBodu account was created in May 2021, and it currently has only 12 tweets. Its display name is "im back for richards ass ANND his bodu" and its bio says "He thought he could block me. But imma get him". Cheshire suspected the account might have been created by Fleming himself. [https://x.com/Thatsregrettab1/status/1397312313531650050] The account seemed to be familiar with several of Fleming's short films, his IMDB videos, and his YouTube videos, which likely few people besides Fleming himself would know about. They supposedly included a Joker video which would match the Batman theme, an audition video, a penis pump video, and a video where Fleming exposed himself in a speedo. The Batman account seems to have wanted Fleming to post his penis on the internet again (which likely few people besides Fleming himself would be interested in): [https://x.com/imbodu/with_replies, https://archive.is/molua]

Incorrect chi-squared comparison of Fleming method and mammography

In 2019 Fleming published a paper titled "Statistical Demonstration that FMTVDM is Superior to Mammography". [https://www.remedypublications.com/open-access/statistical-demonstration-that-fmtvdm-is-superior-to-mammography-5186.pdf] FMTVDM stands for the "Fleming Method for Tissue and Vascular Differentiation and Metabolism", which Fleming claims had a perfect accuracy of detecting breast cancer correctly 1000 times out of a 1000, when mammography detected breast cancer correctly only 828 times out of a 1000:

In the table above, the sum on the row for mammography with cancer absent is wrong, because 142 plus 747 should add up to 889 and not 781. But that's the least of Fleming's problems. The formula he used to calculate the chi-squared test is also wrong, and it has two divisions by zero:

In his formula χ² = E (O-E)2/E, the first E should've been and the second number 2 should've been superscripted: χ² = ∑((O-E)²/E).

Fleming also misunderstood the meaning of the expected counts E in the formula. He treated the results of FMTVDM as the expected counts and he compared them to the results of mammography which he treated as the observed counts. But his observed counts should've consisted of a contingency matrix with one row for mammography and another row for his Fleming method. And then he should've calculated the expected matrix based on the observed matrix by doing a matrix multiplication of the row sums and column sums and then dividing the result with the sum of all values in the contingency matrix:

> m=rbind(mammography=c(77,34,747,142),Fleming_FMTVDM=c(111,0,889,0))
> colnames(m)=c("present_correct","present_incorrect","absent_correct","absent_incorrect")
> m
               present_correct present_incorrect absent_correct absent_incorrect
mammography                 77                34            747              142
Fleming_FMTVDM             111                 0            889                0
> expected=rowSums(m)%*%t(colSums(m))/sum(m)
> expected
     present_correct present_incorrect absent_correct absent_incorrect
[1,]              94                17            818               71
[2,]              94                17            818               71

And only after that he should've calculated sum((observed-expected)^2/expected):

> sum((m-expected)^2/expected)
194.4741
> chisq.test(m,correct=F) # same result
  Pearson's Chi-squared test

data:  m
X-squared = 194.47, df = 3, p-value < 2.2e-16

Here the procedure of calculating the expected matrix is written out using basic arithmetic operations:

> rowsums=c(77+34+747+142,111+0+889+0)
> colsums=c(77+111,34+0,747+889,142+0)
> sum=c(77+111+34+0+747+889+142+0)
> rowsums
[1] 1000 1000
> colsums
[1]  188   34 1636  142
> sum
[1] 2000
> mult=matrix(c(1000*188,1000*34,1000*1636,1000*142,1000*188,1000*34,1000*1636,1000*142),byrow=T,ncol=4)
> mult
       [,1]  [,2]    [,3]   [,4]
[1,] 188000 34000 1636000 142000
[2,] 188000 34000 1636000 142000
> mult/sum # expected matrix
     [,1] [,2] [,3] [,4]
[1,]   94   17  818   71
[2,]   94   17  818   71

I don't know if it would've been better to just use a simple 2 by 2 contingency matrix with one column for the number of correct detections and another column for the number of incorrect detections, but it gave me close to the same chi-squared value as the test with the 4 by 2 matrix:

> m=rbind(mammography=c(77+747,34+142),Fleming_FMTVDM=c(111+889,0+0))
> colnames(m)=c("correct","incorrect")
> m
               correct incorrect
mammography        824       176
Fleming_FMTVDM    1000         0
> chisq.test(m,correct=F)
    Pearson's Chi-squared test

data:  m
X-squared = 192.98, df = 1, p-value < 2.2e-16
> expected=rowSums(m)%*%t(colSums(m))/sum(m)
> sum((m-expected)^2/expected)
[1] 192.9825

Claim that his Twitter account was hacked to add a photo of David Icke

Fleming claimed that his Twitter account had been hacked so that someone had added a photo of David Icke to a poster for Fleming's Crimes Against Humanity Tour: [https://x.com/Doctor_I_am_The/status/1537897704830840836, https://archive.is/2BM0D]

But then was Fleming's Facebook account also hacked? The Facebook account of the tour also has a poster that features David Icke: [https://www.facebook.com/103054418992983/photos/142901295008295/, https://archive.is/qGiFS]

David Icke's blog also said: "I am currently traveling the country with Drs. Judy Mikovits, Richard Fleming and Reiner Fuellmich. Our one-day conference topic in nine cities focuses on the case for crimes against humanity having been committed by leaders of Big Pharma and the biosecurity cartel." [https://davidicke.com/2022/05/24/monkeypox-technocracys-next-wave-of-crimes-against-humanity/]

In 2022 Fleming quoted a tweet that featured the poster and referred to Icke in his tweet. So if the image file of the poster was photoshopped by the hackers, then did the hackers also edit the text of Fleming's tweet so that it referred to the photoshopped poster? [https://x.com/Doctor_I_am_The/status/1537962322576125953]

One of the people featured on the tour was Kevin McCairn, who told me that he asked Fleming to remove Icke from the tour. But even after that, Fleming still denied that Icke was ever included on the tour, and Fleming said "more photoshopping and hacking": [https://x.com/NestCommander/status/1882872073883976179]

Fake clinical trial comparing COVID treatments in 2020

This section about Fleming's fake trial is mainly based on the research of Cheshire. You can read his comments in the comment section of this blog post first: https://retractionwatch.com/2020/05/29/a-convicted-felon-wants-people-to-enroll-in-a-covid-19-clinical-trial-what-could-go-wrong/.

Before Fleming published the paper about his fake trial in a predatory journal, he published two preprint versions of the paper as well as two accompanying short reports. Here's links to all of them for the sake of convenience:

Comments at PubPeer

Cheshire posted this comment about the paper at PubPeer: [https://pubpeer.com/publications/618E865FABF6345892579A16F2AFEB]

Highlights: 23 sites, 7 countries, 1,800 patients, 10 treatment arms. No other authors other than Fleming and son. None of the sites were identified, although the ill-formatted tables (apparently due to unfamiliarity with Acrobat) include Table 3 showing the country of the sites. No funding was required for this study (?).

Interestingly, the Clinicaltrials.gov site shows that on October 8, the first author/sponsor changed the "treatment arms and interventions" details on all of the tested protocols. This is 3 weeks after the trial was marked concluded. An example of the changes:

Experimental: Treatment 1 ORIGINAL

Hydroxychloroquine 200 mg po q 8 hrs (600 mg qD) for a total of 10-days, and Azithromycin 500 mg IV on day 1, followed by 250 mg IV on days 2-5 (to prevent bacterial superinfection).

Experimental: Treatment 1 REVISED

Hydroxychloroquine 200 mg po q 8 hrs (600 mg qD) for a total of 10-days , OR Hydroxychloroquine 155 mg IV every 8-hours (600 mg qD) for 10-days if patient is intubated and Azithromycin 500 mg IV on day 1, followed by 250 mg IV on days 2-5 (to prevent bacterial superinfection). (emphasis added)

Source: https://clinicaltrials.gov/ct2/history/NCT04349410?A=6&B=7&C=merged#StudyPageTop

Other remarks:

Cheshire also pointed out that after the trial is supposed to have already ended, Fleming changed the number of enrollees from 500 to 501 to 1,800:

Trial ended on September 14; at which time clinical trials.gov showed 500 enrollees.

Dr. Fleming posted this on Twitter on September 24, showing 501 enrollees:

On October 2, the sponsor (Dr. Fleming) changed the trial enrollment number to 1,800 at clinicaltrials.gov and 1,800 is the figure used in this preprint.

However the discrepancy seems to be because Table 3 shows that the total number of patients was 1,800, but 1,299 of them were outpatients and the number of inpatients enrolled to phases I and II was 501:

Fleming wrote that "NCT04349410 required identification of a seven-person SARS-CoV-2 treatment team" (where presumably each site would've had its own "treatment team" with at least seven persons, but the study is supposed to have included 23 sites, so 23 times 7 would be 161). Cheshire wrote:

Given the extraordinary requirement that a 7-person treatment team (see below) be formed to treat the 501 hospitalized patients, how is it possible that all this additional care was provided with no funding from the sponsor? Why was this "required identification" not included as part of the pre-registered trial protocols? What evidence does the sponsor have that this "required identification" was followed in every case?

Someone also posted this comment at PubPeer:

It is noteworthy that these ambiguities about the study's feasibility and protocols are reminiscent of earlier skepticism, expressed 18 years ago, about another purported clinical trial from the same author:

...clinical trials are expensive, difficult and time-consuming. Even small dietary trials can easily cost several hundred thousand dollars and require entire research teams. The DPP estimated a cost of $1,075 just to recruit each participant. Fleming reports on a one-year trial of 100 participants and four diets with extensive follow-up. His paper, however, has no co-authors; it acknowledges no source of funding, nor any nurses, dietitians or technicians who might have helped. Fleming identifies himself as Medical Director of Preventive Cardiology, the Camelot Foundation at the Fleming Heart & Health Institute, but if his Web site or receptionist are any indication, he is the sole member of each of those.

As for the issue of peer-review, Fleming states that his patients "were randomly assigned to one of the four dietary regimens based upon dietary preferences." This protocol is pivotal to interpretation of the findings, yet oxymoronic: If patients were assigned to diets based on their dietary preferences, then they weren't randomly assigned. If they were randomly assigned, then their preferences must be irrelevant. The two methods are incompatible. If this paper was peer-reviewed, it was done poorly. If this constitutes high-quality research in this field, then I suggest even more skepticism is necessary.

source: https://www.washingtonpost.com/archive/lifestyle/wellness/2002/09/24/interactions/dfcd1470-eedb-474f-8ae8-714836e810d9/ [Not behind a paywall here: https://www.askbjoernhansen.com/2002/09/02/maybe_it_wasnt_a_big_fat_lie.html]

Cheshire wrote:

This trial does not seem to have been registered in India as appears to be required:

My trial is already registered in another Primary Register, then why do I need to register again with the CTRI? A clinical trial being conducted in India, is also required to be registered in the CTRI as the CTRI captures data specific for the Indian arm of a trial, e.g. Site and PI details, Name of Ethics Committee and approval status, target sample size in India, start date in India etc.

Search here: http://ctri.nic.in/Clinicaltrials/advancesearchmain.php

Zinc treatment in outpatients

Cheshire wrote: [https://pubpeer.com/publications/618E865FABF6345892579A16F2AFEB]

I'm confused again.

From the Methods section of this preprint (posted 10/27/20):

Outpatient Treatment: Patient recruitment for each outpatient treatment site is shown in Tables 3, 4 and Figure 2. Outpatient treatment was by definition provided by clinicians prior to hospital admission. Outpatient sites included private offices, physician and hospital clinics. Decision to treat (Treatments 1-4; Tables 2A and 2B) was made solely by the physician and patient. All outpatients received a minimum of 200 mg of elemental zinc daily while taking aminoquinolines. Following initial evaluation including PCR testing and initiation of treatment or the decision to provide no treatment, patients returned 3-5 days later for re-evaluation." (Emphasis added)

I'm puzzled how the treating physicians would have known to treat patients with 200 mg of zinc daily? In the protocol document dated April 2020 (still available at clinicaltrials.gov), there is no mention of pre-hospitalization or outpatient treatment. On July 4, 2020, an Appendix G was added that added a prehospitalization step which includes, "Begin immune supportive Rx, including Zn." No quantity of Zn is specified.

Further in a late September YouTube video by the first author he recommended 10 mg of daily zinc for prehospitalized COVID-19 patients.

If the protocol provided to physicians at the outset of the trial did not include prehospitalization instructions, but zinc (of unknown quantity) was included beginning in July, and in late September (after the conclusion of this study) the first author was recommending 10 mg daily Zn... how can the author make the statement that all outpatients received a minimum of 200 mg of elemental zinc daily?

Cheshire pointed out that based on this table in Fleming's preprint, all treatment groups received either 10 mg of zinc orally or 4 mg of zinc intravenously:

But Fleming responded by saying that his table showed the treatment regime in hospitalized patients and not outpatients:

However in case zinc was suspected to be helpful in treating COVID, why was the dosage of zinc reduced from 200 mg to 10 mg after a patient was hospitalized? And why did Fleming recommend a dosage of only 10 mg of zinc to outpatients in his YouTube video?

Duration of hospitalization and 99.83% effectiveness

The abstract of Fleming's paper said: "The three successful treatment regimens include (1) Tocilizumab & Interferon a-2b, (2) Primaquine, Clindamycin, Tocilizumab & Interferon a-2b, and (3) Methylprednisolone. These three regimens were effective 99.83% of the time and shortened hospital stays from 40 ± 3 days to 1-2 weeks."

It's not clear how he determined the baseline hospital stay of 40 ± 3 days, because his study did not have any control group. I found no other reference to the figure of 40 ± 3 days apart from the abstract. The average duration of 40 days seems far too long, and the standard deviation of 3 days seems too narrow relative to the average duration.

A meta-analysis of COVID hospitalization studies from 2020 said: "We identified 52 studies, the majority from China (46/52). Median hospital LoS [length of stay] ranged from 4 to 53 days within China, and 4 to 21 days outside of China, across 45 studies." [https://link.springer.com/article/10.1186/s12916-020-01726-3] A meta-analysis from 2021 said: "The mean length of hospital stay due to SARS-CoV-2 infection was 12.5 days (SD 6.8)." [https://pmc.ncbi.nlm.nih.gov/articles/PMC8206636/] In a Brazilian study the mean duration of hospital stay was about 10 ± 8 days. [https://www.sciencedirect.com/science/article/pii/S1876034122001563]

The conclusion of Fleming's paper said: "Successful treatment interventions focused on (1) avoiding intubation or extubating the patient within a matter of days - less than one week - to minimize the ARDS associated ventilator complications associated with the immunologic ITR to SARS-CoV-2, in addition to (2) using a combination of treatments within the first few days of admission including Interferon a-2b, Tocilizumab, and Methylprednisolone. These combinations were most effective if the patient had already received an aminoquinoline as an outpatient, or Primaquine as an inpatient. When provided the administration of convalescent plasma proved effective; however, given the limited supply of convalescent plasma, the potential consequences of a blood product transfusion including increased potential for thrombosis as a plasma product, and the availability of effective ITR treatments, convalescent plasma should be reserved for cases not responding to Interferon a-2b, Tocilizumab, Methylprednisolone, or the combination of Tocilizumab with Interferon a-2b. These ITR drugs proved most promising when initiated upon admission and when used in combination, reducing hospitalization time from 30-45 days to as little as 18-25 days with 0.17% mortality."

However 18 to 25 days is about 2.6 to 3.6 weeks, and not 1 to 2 weeks like Fleming wrote in the abstract.

The mortality rate of 0.17% seems to match the figure of 99.83% effectiveness that Fleming mentioned in the abstract, so at first I thought that by effectiveness, Fleming simply meant the percentage of subjects who did not die. Hovever then I thought I was wrong, because I noticed that he is supposed to have determined whether a treatment was successful based on three biomarkers: "Successful treatment outcomes were defined using the quantitative measurements of FMTVDM with a reduction of ≥ 25, or a level of < 150, Ferritin levels < 270 ng/ml for men and < 160 ng/ml for women, and an IL-6 level of < 5 pg/ml." But next I noticed that Fleming also wrote: "Three hundred and forty patients entered Phase I and received sequentially added medical Treatment(s) until the patient demonstrated treatment success or expired." So apparently all of his imaginary subjects are supposed to have been treated until they either died or they recovered as measured by one of his three biomarkers, which explains why his efficacy against death is the same as his efficacy determined based on the biomarkers.

A mortality rate of 0.17% corresponds to one death per a minimum of 572 people (about 0.1748%) and a maximum of 606 people (about 0.1653%). But I think the study didn't even have 572 subjects who received any of Fleming's so-called "three successful treatment regimes". There were only 501 inpatient subjects, and Fleming's paper said: "Outpatient treatment was by definition provided by clinicians prior to hospital admission. Outpatient sites included private offices, physician and hospital clinics. Decision to treat (Treatments 1-4; Tables 3A & 3B) was made solely by the physician and patient." And Table 3A shows that treatments 1-4 didn't include any of Fleming's "three succesful treatment regimes", even though clindamycin alone was given to some outpatients (in the imaginary realm where Fleming conducted his trial):

All treatment arms had the same baseline levels of ferritin and IL-6

Cheshire pointed out that people in all 11 treatment arms had the same baseline levels of ferritin and IL-6 at admission:

When I asked Fleming to explain it, he replied: "As explained in the paper, although clearly not read or comprehended by others, all participants began at baseline. This was baseline. They were then randomly assigned to treatments and then based upon measured FMTVDM outcomes, additional treatments were added or not. Statistical analysis was by multiple ANOVA." [https://x.com/Doctor_I_am_The/status/1878259706700984586] Then I asked him: "Ok, so did you first measure the ferritin level in each subject and then divided the subjects into treatment arms so that each arm happened to have the same average ferritin level with the same CI? It wouldn't be possible." (Where I should've said SD and not CI.) But Fleming replied: "You obviously are not very good at this and obviously have not read the paper. The sequence was laid out in the paper. You act like the typical student who has a reading assignment, shows up for class not having read the assignment and then try to blame the professor for your lack of understanding. Thus wasting your time, my time and everyone else's time."

But I still don't understand how it's possible for each arm to have the same levels of ferritin and IL-6 at admission.

Comments at Retraction Watch

Someone at Retraction Watch posted this comment: [https://retractionwatch.com/2020/05/29/a-convicted-felon-wants-people-to-enroll-in-a-covid-19-clinical-trial-what-could-go-wrong/]

According to the trial registration, "study chair" Fleming is conducting a clinical trial testing FDA regulated drugs for diagnosis and treatment in patients with Covid-19. Since there are no approved treatments for Covid-19, and IND application to FDA is required.

Per the FDA debarment notice, Fleming is prohibited "for 10 years from providing services in any capacity to a person that has an approved or pending drug product application."

https://www.govinfo.gov/app/details/FR-2018-09-28/2018-21210

Perhaps Retraction Watch could clarify with FDA that the debarment includes provision of services in FDA regulated research.

Cheshire posted this reply:

Source: https://www.healthgrades.com/media/english/pdf/sanctions/HGPYA59E0F8B7C744ECBB05212010.pdf

According to this State of Nebraska "Petition for Disciplinary Action," Fleming is "permanently excluded from Medicare, Medicaid, Tricare, and all other federal healthcare programs."

I verified that he is on the exclusion list accessible here: https://oig.hhs.gov/exclusions/index.asp and that site says:

OIG has the authority to exclude individuals and entities from Federally funded health care programs for a variety of reasons, including a conviction for Medicare or Medicaid fraud. Those that are excluded can receive no payment from Federal healthcare programs for any items or services they furnish, order, or prescribe. This includes those that provide health benefits funded directly or indirectly by the United States (other than the Federal Employees Health Benefits Plan).

OIG maintains a list of all currently excluded individuals and entities called the List of Excluded Individuals/Entities (LEIE). Anyone who hires an individual or entity on the LEIE may be subject to civil monetary penalties (CMP). To avoid CMP liability, health care entities should routinely check the list to ensure that new hires and current employees are not on it.

Based on this, it sounds unlikely that Fleming/Dr. who? would be in a position to legally run a clinical trial.

However I don't know to what extent US regulations would've applied to Fleming's trial since none of his imaginary trial sites were located in the United States. There were 5 sites in India, 4 in Germany, 4 in Brazil, 3 in Philippines, 3 in Cuba, 3 in Belgium, and 1 in South Africa.

The paper about the trial was published in a fake journal

A blog post about the journal where Fleming's paper was published said: [http://flakyj.blogspot.com/2019/11/biomedical-journal-of-scientific.html]

Although the ISSN entry for the Biomedical Journal of Scientific & Technical Research identifies it as a US publication, its mangled management of the English language suggests otherwise. The website describes the goal of this journal's "publishers" as follows:

The only motto of Biomedical Journal of Scientific & Technical Research (BJSTR) Publishers is accelerating the scientific and technical research papers, considering the importance of technology and the human health in the advanced levels and several emergency medical and clinical issues associated with it, the key attention is given towards biomedical research. Thus, asserting the requirement of a common evoked and enriched information sharing platform for the craving readers.

BJSTR is such a unique platform to accumulate and publicize scientific knowledge on science and related discipline. This multidisciplinary open access publisher is rendering a global podium for the professors, academicians, researchers and students of the relevant disciplines to share their scientific excellence in the form of an original research article, review article, case reports, short communication, e-books, video articles, etc.

BJSTR Publishers are self supporting, with no dependency on any other external sources (like universities, centers) for funds and strives for the best and enhanced quality publications competes the world wide open access publishing market.

We always rely on the support from the members of our BJSTR family that is relevantly our Authors, Editorial Committee members, advisory board, Reviewers Board and all the technical support teams all over the globe. We trust in the reciprocated coordination and cooperation in terms of sharing the scientific knowledge of individuals and Groups of Research centers/areas will in turn educates and provokes in advanced researches. In this case we would like to act as a media that anchors in the transformation of information in the form of global online publication.

With writing like this, the absence of "dependency on any ... external sources (like universities, centers) for fund" is understandable. So is the fact that the journal is not in the National Library of Medicine collection and not indexed for Medline.

When one researcher "submitted a string of machine-generated nonsense" entitled "The Expression of the Proper-Name Effect Reinforces the Disarticulation ofCommunicative [sic] Rationality," the article was "quickly accepted after scrupulous peer review." Evidently, the editors did not notice that the author was Harold E. Potter of the Institute of Improbabilistics, University of Bogus, UK. An author posting on Researchgate reports that when he declined to pay the $600 fee, the journal dropped the price to $99.

Wisely, the publishers do not reveal their identities. The domain name biomed-res.org in the email is registered to a privacy service. The contact information on the website is Biomedical Research Network+, LLC, 1 Westbrook Corporate Center, Suite 300, one Westchester, IL 60154, USA +1 (720) 414-3554 Fax - (720) 367-5187 info@biomedres.us angelaroy@biomedres.us. The registrant of biomedres.us provides the same physical address along with the name Biomedical Research Network + LLC and email URL of openaccessnetworks@gmail.com. The Westbrook Corporate Center is a property with "virtual office" space on sale for as little as $2 a day.

Someone posted this comment to the blog post: "ALL these BJSTR, IRIS, CRIMSON, LUPINE are interconnected to SRAWIK GROUP a proprietor company in Hyderabad India". However I'm not sure if it's correct or not, because there were no other hits on Google when I searched for srawik "biomedical journal of scientific".

The associate editor of the BJSTR journal is suposed to be someone called "Angela Roy", whose location at Twitter is listed as "600 Third Avenue, 2nd floor, New York - 10016, USA". [https://x.com/Biomedres01] Her bio at Orcid doesn't have any publications listed, but it describes BJSTR in broken English, like "We crave to select ground-breaking research based on modernism, aptness, scientific connotation, prospective spectator's interests, etc." [https://orcid.org/0000-0002-4278-5729]

Crimes Against Humanity affidavit

This section addresses the PDF linked at the top of this page: https://www.flemingmethod.com/crimesagainsthumaniy. (Archive link: http://web.archive.org/web/20240217163948/https://www.flemingmethod.com/_files/ugd/659775_6532f42cb0b24f92bb36e224b7abac81.pdf.)

Chi-squared calculation of COVID cases in vaccine trials

Fleming wrote: "When the EUA documents were used for the statistical analysis of the Pfizer, Moderna, and Janssen Drug Vaccine Biologics, and the Chi-Square analysis of the results published in those EUA documents was analyzed for the Pfizer vaccine as shown in the following graphic, there was no statistical difference between vaccinated and un-vaccinated people diagnosed with having COVID-19. To be statistically different (a benefit for people being vaccinated) the 'p (probability)- value' must be less than or equal to less than 5 times per hundred people. This is the scientific definition of statistical benefit and is written as 'p<0.05'. In the graphic the p-value was 0.224418 [sic; actually 0.244218] and is NOT statistically significant; i.e. there is no statistical difference in the number of people diagnosed with COVID who were vaccinated when compared with the non-vaccinated group of people." And he showed the image below, where the table on the left is from a review memorandum for the emergency use authorization of the Pfizer vaccine. [https://www.fda.gov/media/144416/download] And the images on the right show Fleming's own incorrect calculation:

There were 8 cases out of 17,411 people in the vaccine group and 162 cases out of 17,511 people in the placebo group, so common sense should've told Fleming that the difference between the groups was statistically significant, and he should've noticed that there was something wrong with his calculation because he only got a p-value of about 0.24.

In Fleming's contingency matrix, the "observed" column shows the number of people with no case, or for example 17411-8=17403 for Pfizer. But I don't understand how he calculated the "expected" column. The numbers in parentheses show the result of rowSums(m)%*%t(colSums(m))/sum(m) (for example 34652*34752/69503=17326.25 for the top left square).

However the proper way to make the contingency matrix would've been to have one column for the number of people with a COVID case and another column for the number of people with no COVID case. It gave me a p-value of about 9e-32 here:

> cases=c(8,162);people=c(17411,17511)
> m=cbind(case=cases,no_case=people-cases)
> rownames(m)=c("Pfizer","placebo")
> m
        case no_case
Pfizer     8   17403
placebo  162   17349
> chisq.test(m) # p-value shown as `<2.2e-16` due to limit of floating point precision
  Pearson's Chi-squared test with Yates' continuity correction

data:  m
X-squared = 137.5, df = 1, p-value < 2.2e-16

> .Machine$double.eps # smallest positive float `x` where `1+x!=1`
[1] 2.220446e-16
> chisq.test(m)$p.value # approximation of actual p-value
[1] 9.395097e-32
> expected=rowSums(m)%*%t(colSums(m))/sum(m)
> expected
        case  no_case
[1,] 84.7566 17326.24
[2,] 85.2434 17425.76
> sum((m-expected)^2/expected) # manual calculation without correction
[1] 139.3046
> chisq.test(m,correct=F)$stat # matches manual calculation
X-squared
 139.3046

Kevin McCairn also got a similar p-value when he used MATLAB to do a chi-squared test (but the reason why McCairn said he got a lower p-value than me was because my p-value was shown as < 2.2e-16 by R even though it was actually about 9e-32 which was similar to McCairn's result). McCairn wrote: [https://x.com/NestCommander/status/1882185862257242263]

Richard I'm not following the logic, not that I trust Pfizer data, but the appropriate use of the Chi-squared in the tables above would be calculated as follows (MATLAB code below), I get a smaller P Value than Henjin, but I did no post-hoc corrections as it's only a 2x2 contingency table, and the result is highly significant.

% Data
observed = [8, 162; 17403, 17349]; % Observed frequencies
total = sum(observed, 'all');
row_totals = sum(observed, 2);
col_totals = sum(observed, 1);

% Expected frequencies
expected = (row_totals * col_totals) / total;

% Chi-squared calculation
chi_squared = sum((observed - expected).^2 ./ expected, 'all');

% Degrees of freedom
df = (size(observed, 1) - 1) * (size(observed, 2) - 1);

% P-value calculation
p_value = 1 - chi2cdf(chi_squared, df);

% Critical value for p = 0.05
critical_value = chi2inv(0.95, df);

% Display results
fprintf('Chi-squared statistic: %.2f\n', chi_squared);
fprintf('Degrees of freedom: %d\n', df);
fprintf('Critical value (p=0.05): %.2f\n', critical_value);
fprintf('P-value: %g\n', p_value); % Use %g for full precision scientific notation

% Conclusion
if chi_squared > critical_value
    disp('The result is significant at p = 0.05.');
else
    disp('The result is not significant at p = 0.05.');
end

The result is significant at p = 0.05
χ2=139.3046
P=7.89×10−32

Claim that no other coronavirus has a furin cleavage site

Fleming wrote "No other Coronavirus contains a Furin Cleavage site as shown in the following graphic":

But his graphic only contained sarbecoviruses, and not other types of coronaviruses.

Many merbecoviruses like MERS and HKU5 have a furin cleavage site at the S1/S2 junction. The closest relative of sarbecoviruses are hibecoviruses, which are a small subgenus of betacoronaviruses that I believe currently includes only 4 published virus sequences, which are Hp-betacoronavirus/Zhejiang2013, Zaria bat coronavirus ZBCoV, CD35, and CD36. But all of them except ZBCoV have an FCS at the S1/S2 junction:

Feline infectious peritonitis virus is also a coronavirus, but there are sequences of FIPV that have an FCS at the S1/S2 junction with the residues PRRAR:

Claim that the likelihood of an FCS occurring spontaneously is 3.21e-11

Fleming wrote: "The odds of such a cleavage site occurring spontaneously (naturally) is 3.21 x 10-11. [...] Simply put, the Furin cleavage site 'critical' for the SARS-CoV-2 viruses' entry into human cells resulting in disease and death, is astronomical. It has it not found in any other coronavirus at the critical S1/S2 location, and the US Government which has funded the Gain-of-Function research, owns the patent for this Furin Protease Cleavage Site, also associated with the HIV glycoprotein (HIV gp120) 120 (sialic acid raft receptor) and cancer progression."

The figure of 3.21e-11 comes from a paper by Ambati et al. titled "MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site". [https://frontiersin.org/journals/virology/articles/10.3389/fviro.2022.834808/full] But in the paper 3.21e-11 was not calculated to be the odds of an FCS occurring naturally but the odds that a given 19-base sequence would be contained both within a random 30,000-base sequence and within a set of 24,712 random 3,300-base sequences.

The paper by Ambati et al. included the image below with this caption: "Calculations of the probability of natural occurrence of the 19nt sequence under study. The SARS-CoV-2 genome is ~30,000 nucleotides long (P1). The patented sequence is ~3,300 nucleotides long (P2). The patented library encompasses 24'712 sequences of varying lengths with median length being in the range of 3,300 nucleotides. Conventional probability calculations are given of the probability of the presence of a 19-nucleotide sequence in the human genome and in one of the patented library sequences."

Ambati calculated the likelihood that a given 19-base segment would be included in SARS-CoV-2, and he multiplied it with the likelihood that the same segment would be included in the single Moderna patent that happened to match the 19-base segment. But he should've instead just calculated the likelihood that a given 19-base segment would match the Moderna patent by chance, like what he did in his P2c probability, or the likelihood that a given 19-base segment would match any Moderna patent published before 2020.

In order to search the patent BLAST database for sequences that were published before 2020 and that matched the keyword "Moderna", I used the Entrez query 0:2019[dp] Moderna. It returned a total of 669,810 sequences with a total length of about 1,011,731,339 bases. So if all sequences are assumed to be random, then the likelihood that any of them would match a given 19-base segment would be about 0.007: 1-((1-.25^19)^(1e9*2)) (where the likelihood of one or more matches is calculated by subtracting the likelihood of zero matches from 1, and 1-.25^19 is the likelihood that a single 19-base segment doesn't match the target sequence, and 1e9*2 is the approximate number of 19-base segments on both strands in all Moderna patent sequences). But since there's 8 different ways to choose a 19-base segment of SARS-CoV-2 that contains the FCS insert and a total of 7 surrounding bases from either side combined, you can further multiply the likelihood by 8.

The journal that published Ambati's paper later published a response to his paper, which pointed out these problems with his probability calculation: [https://www.frontiersin.org/journals/virology/articles/10.3389/fviro.2022.914888/full]

Ambati et al. said that the sequence listing included in the 5 Moderna patents contained a total of 24,712 sequences, but I don't know where they got the figure, because actually the sequence listing contains 33,915 sequences, out of which 4,573 are amino acid sequences and 406 are RNA sequences that contain U bases. The remaining number of DNA nucleotide sequences is 28,936, which doesn't match Ambati's number of 24,712 sequences. Ambati guessed that the median length of the sequences was about 3,300 bases, but it doesn't match my calculation, where the median length was 1,250.5 bases when I excluded the amino acid and RNA sequences.

But anyway, Fleming was wrong to say that "the odds of such a cleavage site occurring spontaneously (naturally) is 3.21 x 10-11". The likelihood that the FCS would occur spontaneously is not the same as the likelihood that a specific Moderna patent would happen to match the specific insert that happened to add the FCS along with 7 surrounding bases. There are also many other possible inserts that could've added an FCS to SARS-CoV-2, and even many combinations of point mutations that could've added an FCS. The FCS sequence only needs to have two arginine residues with two other residues in between, and the sequence can be located at multiple different spots near the S1/S2 junction.

There are 6 different codons for arginine, so there are many different ways to introduce mutations that produce an arginine residue. For example in RaTG13, the codons after the spot where Wuhan-Hu-1 has RRAR are S:agt V:gta A:gct S:agt, but it would change to RVAR if the 3rd nucleotide was changed to A or G and the 12th nucleotide was changed to A or G.

The codons around the S1/S2 junction in RaTG13 are T:act N:aat S:tca R:cgt S:agt V:gtg A:gcc, which would match RXXR if either the T at the start or the A at the end changed to R. But there's 3 combinations of 2 nucleotide changes and 3 combinations of 3 nucleotide changes which would change the T at the start to R, and there's 1 combination of 2 nucleotide changes and 5 combinations of 3 nucleotide changes which would change the A at the end to R.

The likelihood that the 12-base FCS insert would occur by chance is not even the same as the likelihood that the 12-base FCS insert and the 7 surrounding bases would occur by chance. And the likelihood that the specific FCS motif in Wuhan-Hu-1 would occur by chance is not the same as the likelihood that any FCS motif would occur by chance. And the likelihood that the FCS insert in Wuhan-Hu-1 would occur naturally is not the same as the likelihood that it would occur by chance, because certain mutations might be favored by natural selection. And the likelihood that the 19-base segment happened to match one specific Moderna patent is not the same as the likelihood that the 19-base segment would have occurred naturally.

In order to estimate the likelihood that the 12-base insert and a total of 7 surrounding bases from either side would have an exact match in the patent database, you can go here: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn. Set the query sequence to ACTAATTCTCCTCGGCGGGCACGTAG, which consists of the 12-base FCS insert and 7 surrounding bases from either side. Then switch the database to patent sequences, insert "SARS-CoV-2 (taxid:2697049)" as the organism and click the exclude checkbox, and under algorithm parameters set maximum results to 1000, and then click "BLAST". When I ran the query, the first 392 matches were mostly matches to SARS-CoV-2 that were not removed by the species filter, but the matches to the Moderna patent sequences were listed on rows 393 to 396 (JP 2017197545-A/7090, JP 2017197545-A/7089, JP 2015518816-A/7090, and JP 2015518816-A/7089). However the E-value of all matches was about 0.34, which means that about 0.34 similarly close or closer matches were expected to occur by chance in the patent database:

The E-value depends on the size of the database, and the patent database is fairly small compared to other BLAST databases like the core nucleotide database. So when I repeated the previous search but I switched to the core nucleotide database, there were a bunch of bacterial sequences that got a perfect match to some 19-base subsegment of the 33-base query, but the E-values of the matches were about 8.9, which means that about 8.9 similarly close or closer matches were expected to occur by chance.

As an indication of how likely 19-base matches are to occur by chance, there are 29,885 different 19-base segments of Wuhan-Hu-1, but 1,670 or about 6% of them had an exact match to the GRCh38 human reference genome:

$ brew install bowtie2 seqkit
$ wget ftp://ftp.ccb.jhu.edu/pub/data/bowtie_indexes/GRCh38_no_alt.zip;unzip GRCh38_no_alt.zip
$ curl -s 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=MN908947'>sars2.fa
$ seqkit seq -s sars2.fa|awk -F '' '{for(i=1;i<length-18;i++)print ">"i"\n"substr($0,i,19)}'>frag.fa
$ bowtie2 -p4 --no-unal -x GRCh38_noalt_as/GRCh38_noalt_as --score-min C,0,-1 -fU frag.fa>temp
29884 reads; of these:
  29884 (100.00%) were unpaired; of these:
    28214 (94.41%) aligned 0 times
    1427 (4.78%) aligned exactly 1 time
    243 (0.81%) aligned >1 times
5.59% overall alignment rate

Ambati's 19-base segment matches bases 23601 to 23619 of Wuhan-Hu-1, which consists of the codons for PRRAR and 2 surrounding bases on from both sides. The 19-base segment matches the 12-base insertion in Wuhan-Hu-1 and the next 7 bases. Jikkyleaks has made a huge deal about Ambati's BLAST match, which he has dubbed "Modernagate". His theory is that SARS-CoV-2 acquired the 12-base insert in a cell culture from the human MSH3 gene through an accidental recombination event, so that the 7 flanking bases after the insert somehow helped facilitate the accidental recombination. His theory doesn't make any sense, but even if it did, it's not clear if the 7-base flanking region after the insert would've helped to facilitate accidental recombination much better than a 6-base or 5-base flanking region. And if the last two bases from Jikky's segment are left out so the flanking region is only 5 bases long, then the 17-base segment has a perfect match to all of these patent sequences published before 2020:

$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=xml&id=HC903376,HC915932,HC908933,HC905783,HB443296,GN095906,BD179519'>temp.xml
$ xmlstarlet fo -D temp.xml|xml sel -t -m //GBSeq -v GBSeq_accession-version -o \| -v GBSeq_definition -o \| -v GBSeq_create-date -o \| -v .//GBReference/GBReference_title -o \| -v .//GBReference/GBReference_journal -o \| -n|awk -F\| '$3!~/202/'
HC903376.1|Sequence 13528 from Patent EP2194140|18-JUN-2010|Process for the production of fine chemicals|EP2194140-A2 13528 09-JUN-2010 Metanomics GmbH (DE)|
HC915932.1|Sequence 26085 from Patent EP2194140|18-JUN-2010|Process for the production of fine chemicals|EP2194140-A2 26085 09-JUN-2010 Metanomics GmbH (DE)|
HC908933.1|Sequence 19086 from Patent EP2194140|18-JUN-2010|Process for the production of fine chemicals|EP2194140-A2 19086 09-JUN-2010 Metanomics GmbH (DE)|
HC905783.1|Sequence 15936 from Patent EP2194140|18-JUN-2010|Process for the production of fine chemicals|EP2194140-A2 15936 09-JUN-2010 Metanomics GmbH (DE)|
HB443296.1|Sequence 19 from Patent WO2009077406|14-JUL-2009|Lipid metabolism proteins, combinations of lipid metabolism proteins and uses thereof|WO2009077406-A1 19 25-JUN-2009 BASF Plant Science GmbH (DE)|
GN095906.1|Sequence 687 from Patent WO2009037279|16-APR-2009|Plants with increased yield|WO2009037279-A1 687 26-MAR-2009 BASF Plant Science GmbH (DE)|
BD179519.1|Highly thermophilic bacterium-derived protein and gene encoding it|15-MAY-2003|Highly thermophilic bacterium-derived protein and gene encoding it|JP2002325574-A 10 12-NOV-2002 THE INSTITUTE OF PHYSICAL AND CHEMICAL RESEARCH|

To reproduce the output of code above, go here: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn. Enter CTCCTCGGCGGGCACGT to the field at the top, switch the database to "Patent sequences(pat)", and click "BLAST". Then copy the accession numbers up to the last result where query coverage and identity are both 100%, and run the code above with the accession IDs joined by commas inserted as the id parameter.

All 5 Moderna patents have the same sequence listing that contains a total of 33,915 sequences. It's unusual for a single patent to include so many sequences, so McKernan said the patents were "kitchen sink patents". You can download all sequences from here: https://seqdata.uspto.gov/docdetail?docId=US09587003B2. Their average length is about 1,700 bases and their total length is about 58 million bases:

$ unzip US09587003-20170307-SUPP.zip
$ sed 's/.*SEQUENCE: />/;/^[< ]/d;s/  *[0-9]*\r$//;s/ //g' Psips/Data/03/US/2017/870/095/B2/sequence/US09587003-20170307-S00001.TXT|seqkit stat
file        format  type  num_seqs     sum_len  min_len  avg_len  max_len
moderna.fa  FASTA   DNA     33,915  57,673,267        7  1,700.5   18,787

The sequence listing contains 4,573 amino acid sequences and 406 RNA sequences. And out of the remaining 28,936 sequences, 24,363 sequences don't have any stop codons in the middle if they are translated:

$ tr -d \\r<Psips/Data/03/US/2017/870/095/B2/sequence/US09587003-20170307-S00001.TXT|awk '/TYPE: DNA/' RS= 'ORS=\n\n'|sed 's/<400> SEQUENCE: />/;/^[< ]/d;s/  *[0-9]*$//;s/ //g'|seqkit grep -svp u>moderna.fa
$ seqkit translate moderna.fa|seqkit grep -svrp'\*.'|seqkit stat
file  format  type     num_seqs     sum_len  min_len  avg_len  max_len
-     FASTA   Protein    24,363  12,482,339        3    512.3    5,891

When I generated all 19-base segments of Wuhan-Hu-1 with the poly(A) tail removed, and I searched for the segments within the sequence listing in the Moderna patents, there were 3 other 19-base segments besides Jikky's segment that had a perfect match to the patent sequences:

$ bowtie2-build --thread 4 moderna.fa{,}
$ seqkit replace -sip'a*$' sars2.fa|seqkit sliding -W19 -s1|seqkit replace -p'.*:'>frag.fa
$ bowtie2 -p4 --no-unal -x moderna.fa --score-min C,0,-1 -fU frag.fa>moderna.sam
$ (echo sars2_pos patent_sequence_number match_start_in_patent_sequence sequence;grep -v ^@ moderna.sam|cut -f1,3,4,10)|column -t
sars2_pos    patent_sequence_number  match_start_in_patent_sequence  sequence
3180-3198    18510                   967                             AAGAAGAGCAAGAAGAAGA
4459-4477    26445                   1172                            AGTTTCAACTATACAGCGT
8293-8311    30068                   1160                            CTATAACAAAGTTGAAAAC
23601-23619  11651                   2760                            CTACGTGCCCGCCGAGGAG

If the amino acid and RNA sequences are excluded, the Moderna patents have a total of about 49 million 19-base segments. And there's 29,885 19-base segments in Wuhan-Hu-1. So if both collections of segments would be random, the expected number of exact matches between the collections would be .25^19*49159360*29885*2, which is about 11.

Jikky wrote about his 19-base segment that "In order for that sequence to have arisen in that virus, the virus which was manufactured with its HIV inserts, had to have had been infected into patented cell lines supplied by Moderna that had that unique sequence not seen in any other virus." [https://www.arkmedic.info/p/how-to-blast-your-way-to-the-truth] However it's possible for bioweaponeers to edit the genome as a text file and then synthesize the whole genome, so they don't have to find a cell line which contains the 12-base segment they want to insert, then infect that cell line with the virus a zillion times until the right piece of the cell line's genome happens to get inserted to the right spot of the viral genome by chance. In the comments of Jikky's Substack post, Jennifer Smith who is a PhD virologist also said that "the 'accidental' nature you implied is less likely than purposeful construction". [https://www.arkmedic.info/p/how-to-blast-your-way-to-the-truth/comment/4545048]

Jikky stated it as a fact that SARS-CoV-2 was made using an MSH3 cell line patented by Moderna, because he wrote: "Irrespective of whether it was released there it distracts from the fact that it was made in a lab using a Moderna patented MSH3_mut cell line." [https://x.com/JikkyKjj/status/1474581145979293702]

Kevin McKernan was blocked by Jikky in 2022 after McKernan debunked Modernagate in this thread: https://x.com/Kevin_McKernan/status/1484987210508255233. I recommend reading the whole thread. McKernan said that Jikky had dumped his reputation on a Bible codes misunderstanding of BLAST: [https://x.com/search?q=from%3Akevin_mckernan+to%3Ajikkykjj+since:2022-2-10&f=live]


Added later: Modernagate was now also debunked here by the Japanese patent expert Patent_SUN: https://x.com/Patent_SUN/status/1901917154578202855. I won't copy the whole thread here, but for example he wrote:

The following five patent publications ① to ⑤ each includes the above reverse complementary sequence in its Sequence Listing, but no patent rights have been granted to the reverse complementary sequence itself.

①US9149506B2
②US9216205B2
③US9255129B2
④US9301993B2
⑤US9587003B2

Therefore, we must carefully explain the reverse complementary sequence so as not to mislead the public. Regarding those patent publications ① to ⑤, by referring to the "We claim" section (scope of Claims) attached to the end of each specification, we can understand where the patent rights exist.

As we can see in each "We claim" section of the patent publications ① to ⑤, there is no description of "CTACGTGCCCGCCGAGGAG."

From this fact, we can understand that the patent rights have NOT been granted to it.

[...]

The topic has strayed off course, but realistically, it is not possible for Moderna to obtain a patent for this specific sequence, "CTACGTGCCCGCCGAGGAG," or just a part of it (i.e., the furin cleavage site). This is because Moderna disclosed "SEQ ID 11652" as a complete sequence, which includes that specific sequence, but did not disclose the segment as an independent invention. This fails to meet the support requirement for patentability, and it is unlikely that a patent will be granted for this specific sequence in the future.

Furthermore, even if Moderna were to attempt to obtain a patent right for "SEQ ID 11652," I believe it would be a difficult process. Realistically, if Moderna were to pursue a patent right for "SEQ ID 11652," the specification would need to explicitly describe the usage, function, and effects of "SEQ ID 11652" in order to meet the aforementioned support requirement. However, none of the specifications in the Patents 1 to 5 mention "SEQ ID 11652," nor is there any disclosure suggesting it.

Additionally, Moderna does not address the complementary sequence of "CTACGTGCCCGCCGAGGAG," which is "CTCCTCGGCGGGCACGTAG," anywhere in the specification. Therefore, the patent rights of the Patents 1 to 5 never extend to the 'CTCCTCGGCGGGCACGTAG' sequence of the COVID-19 virus.


Another addendum: I went to nucleotide BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn. I entered the accession of SARS-CoV-2 to the text field at the top ("NC_045512"), and I changed the database to patent sequences. In order to search for patent sequences that were published before 2020 and that matched the word "Moderna" in any of the fields, I specified the Entrez query as 0:2019[dp] Moderna. Then under algorithm parameters, I reduced the word size to 16, increased the expect threshold to 1000, and increased maximum target sequences to 1000.

There were a total of 495 results. The best matches with 100% identity were 23 bases long, but even they had an expect value of about 2.3, which means that about 2.3 similarly close or closer matches were expected to occur by chance:

The expect values of the perfect 19-base matches were about 381, which means that about 381 similarly close or closer matches were expected to occur by chance. (And that wasn't even in the whole patent database, but only within the set of patent sequences that were published before 2020 and that matched the word "Moderna".)

Then in order to download a TSV file of the results, I clicked "Download" and selected "Hit Table (text)". The TSV file shows that there were 176 perfect matches with a length of 19 bases, 55 with length 20, 6 with length 21, 13 with length 22, and 6 with length 23:

$ awk '$3==100&&$4>=19{a[$4]++}END{for(i in a)print i,a[i]}' Downloads/XRM91BX9013-Alignment.txt
19 176
20 55
21 6
22 13
23 6

The perfect matches that were at least 19 bases long came from 256 unique patent sequences:

$ awk '$3==100&&$4>=19' Downloads/XRM91BX9013-Alignment.txt|cut -f2|sort -u|wc -l
256

Among the perfect matches that were at least 19 bases long, there weren't even too many duplicate matches, because the matches started at 92 unique positions of the genome of SARS-CoV-2, and they covered 1,532 bases of the genome of SARS-CoV-2 which is about 5% of the total length of the genome:

$ awk '$3==100&&$4>=19' Downloads/XRM91BX9013-Alignment.txt|cut -f7|sort -u|wc -l
92
$ awk '$3==100&&$4>=19{for(i=$7;i<=$8;i++)a[i]}END{print length(a)}' Downloads/XRN2HBFD016-Alignment.txt
1532

When I clicked "Search Summary", it showed that there were a total of about 700,000 sequences in the patent database that matched the Entrez query 0:2019[dp] Moderna, and their total length was about a billion bases:

The total length of all sequences in the patent database in March 2025 was about 28.3 billion bases. So about 4% of the total length was made up by sequences that were published before 2020 and that matched the keyword "Moderna".

The next plot shows all matches with the same or lower expect value as the match to Jikky's 19-base segment, where the matches on the top row are similarly close as Jikky's match, and the matches on the 4 rows below it are closer than Jikky's match:

t=fread("http://sars2.net/f/modernagate-blast.txt")
p=unique(t[,.(start=qstart,end=qend,expect=evalue,mismatch=mismatch+gaps)])

gene=fread(text="name,start,end
1a,266,13468
1b,13468,21555
S,21563,25384
3,25393,26220
E,26245,26472
M,26523,27191
6,27202,27387
7,27394,27759
8,27894,28259
N,28274,29533
10,29558,29674")
bars=gene[,c(start[1],pmean(start[-1],end[-.N]),end[.N])]

exp=.16;ylim=10^(c(-1,1)*exp+log10(range(p$expect)))
ybreak=unique(p$expect);xend=29903;xbreak=c(seq(1,xend,2e3),xend)

color=c("black","gray60",hsv(c(20,12,6,3,0,31,27)/36,1,.7))

annox=23601+10;annoy=10^(log10(381)-exp);annoy2=10^mean(log10(ybreak[3:4]))

ggplot(p)+
annotate("rect",xmin=1,xmax=xend,ymin=ylim[1],ymax=ylim[2],linewidth=.4,lineend="square",color="gray75",fill=NA)+
geom_vline(xintercept=bars,color="gray75",linewidth=.4,lineend="square")+
geom_rect(aes(fill=factor(mismatch),xmin=start,xmax=end,ymin=10^(log10(expect)-exp),ymax=10^(log10(expect)+exp)))+
geom_point(aes(color=factor(mismatch),x=pmean(start,end),y=expect),size=1.5,stroke=0)+
geom_text(data=gene,aes(x=pmean(start,end),y=ylim[1],label=name),size=3.5,hjust=.5,vjust=-.7)+
annotate("segment",x=annox,xend=annox,y=annoy2*1.3,yend=annoy,arrow=arrow(type="closed",length=unit(4,"pt")),lineend="butt",linejoin="mitre",color="red",size=.5)+
annotate("text",x=annox,y=annoy2,size=3.8,color="red",label="#CTCCTCGGCGGGCACGTAG")+
labs(x=NULL,y="Expect value",title="BLAST matches to SARS-CoV-2 in patent sequences published before 2020 matching keyword \"Moderna\"")+
scale_x_continuous(limits=c(1,xend),breaks=xbreak)+
scale_y_log10(breaks=ybreak,labels=ifelse(ybreak>=10,round(ybreak),ybreak))+
scale_color_manual(values=color,name="Mismatches")+
scale_fill_manual(values=color,name="Mismatches")+
coord_cartesian(clip="off",expand=F)+
theme(axis.text=element_text(size=10,color="black"),
  axis.text.x=element_text(margin=margin(3)),
  axis.ticks=element_line(size=.4,color="gray75"),
  axis.ticks.length=unit(4,"pt"),
  legend.background=element_blank(),
  legend.key=element_blank(),
  legend.key.height=unit(13,"pt"),
  legend.key.width=unit(13,"pt"),
  legend.spacing.x=unit(3,"pt"),
  legend.text=element_text(size=11),
  panel.background=element_blank(),
  plot.margin=margin(5,5,5,5,"pt"),
  plot.title=element_text(size=11,face=2,margin=margin(1,,5)))
ggsave("1.png",width=8.5,height=2.4,dpi=300*4)

sub="The patent BLAST database was searched for matches to Wuhan-Hu-1. The Entrez filter `0:2019[dp] Moderna` was used to select sequences that were published before 2020 and that matched the keyword \"Moderna\", which kept a total of about 700,000 sequences with a total length of about 1 billion bases. The match to #CTCCTCGGCGGGCACGTAG had an expect value of about 381, which means that about 381 similarly close matches were expected to occur by chance among the filtered set of patent sequences. There were a total of 495 matches to SARS-CoV-2 with the same or lower expect value, out of which 215 matches were unique. All unique matches are shown here. The length of the matches ranges from 19 to 40 bases. The matches cover 3,524 out of 29,903 bases of Wuhan-Hu-1. The blastn task was used with a word size of 16."
system(paste0("mogrify -trim 1.png;magick 1.png \\( -size `identify -format %w 1.png`x -font Arial -interline-spacing -3 -pointsize $[43*4] caption:'",gsub("'","'\\\\'",sub),"' -splice x80 \\) -append -resize 25% -bordercolor white -border 24 -dither none -colors 256 1.png;pngcrush -rem alla -reduce 1.png 1.png"))

When I searched the nucleotide database at GenBank for the query 0:2019[dp] moderna patent, there were a total of 671,931 results, which is close to the same as the number of sequences in the patent BLAST database that matched the query 0:2019[dp] moderna. [https://www.ncbi.nlm.nih.gov/nuccore/?term=0%3A2019%5Bdp%5D+moderna+patent] So there's a huge number of Moderna patent sequences at GenBank.


All five Moderna patents have the same sequence listing of 33,915 sequences. I used to think the listing included codon-optimized versions of nearly all human protein-coding genes, but in fact the sequence listing seems to be mainly focused on oncology-related genes. There are about 20,000 human protein-coding genes, but when I translated all DNA sequences in the patent listing, did a BLAST search of them against human protein-coding genes, and kept only the first match for each patent sequence, I got matches with an E-value below 1e-5 for only 1,207 unique genes:

wget ftp://ftp.ensembl.org/pub/release-109/fasta/homo_sapiens/cds/Homo_sapiens.GRCh38.cds.all.fa.gz
seqkit fx2tab Homo_sapiens.GRCh38.cds.all.fa.gz|grep transcript_biotype:protein_coding|awk '!a[$7]++'|seqkit tab2fx|seqkit translate>proteincoding.aa

blap()([[ -e $1.pdb ]]||makeblastdb -dbtype prot -in "$1";blastp -outfmt '6 qseqid bitscore evalue pident qcovs length qlen slen stitle qstart qend sstart send' -db "$@")

tr -d \\r<Psips/Data/03/US/2017/870/095/B2/sequence/US09587003-20170307-S00001.TXT|awk '/TYPE: DNA/' RS= 'ORS=\n\n'|sed 's/<400> SEQUENCE: />/;/^[< ]/d;s/  *[0-9]*$//;s/ //g'|seqkit grep -svp u>moderna.fa

<moderna.fa blap proteincoding.aa -evalue 1e-5 -num_threads 7 -word_size 7 >blast
awk -F\\t '!a[$1]++{b[$9]}END{print length(b)}' blast2
# 1207

Alex Washburne's endonuclease fingerprint paper

Fleming's affidavit referred to Alex Washburne's paper titled "Endonuclease fingerprint indicates a synthetic origin of SARS-CoV-2".

The paper said: "Fisher's exact test was used to assess if there was a higher rate of silent mutations within BsaI/BsmBI recognition sites compared to the rest of the viral genome. Odds ratios were computed as the ratio of silent mutations to all other nucleotides within BsaI/BsmBI sites of either genome in a pairwise alignment compared to the ratio of silent mutations outside BsaI/BsmBI sites to all other nucleotides. There are 12 silent mutations found in 9 distinct BsaI/BsmBI sites between RaTG13 and SARS-CoV-2, and 882 silent mutations outside of BsaI/BsmBI sites." [https://europepmc.org/article/ppr/ppr560730]

The BsaI recognition sequence is GGTCTC and the BsmBI recognition sequence is CGTCTC, so both of them are 6 bases long. So the total length of the 9 recognition sites is 9*6 which is 54 bases.

So the Fisher's test can be calculated like this:

recognition_silent=12
recognition_total=54
other_silent=882
genome_length=29903

m=c(recognition_silent,recognition_total-recognition_silent)
m=c(m,other_silent,genome_length-other_silent-recognition_total)
fisher.test(matrix(m,2))$p
# 5.120702e-08

However Guy Gadboit showed here why Washburne's logic of calculating the p-values and odds ratios was wrong: https://x.com/gadboit/status/1833191562961887679. After Gadboit corrected the calculation, he got the odds ratios to be centered around 1 and not around 2 like in Washburne's code. See also these threads: https://x.com/gadboit/status/1748538944717750619, https://x.com/gadboit/status/1702271854671462655.

There's 5 BsaI/BsmBI recognition sites in Wuhan-Hu-1 and 6 in RaTG13, but 2 of them are included in both so there's 9 distinct sites:

$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=MN908947'>sars2.fa
$ seqkit locate -rip'ggtctc|cgtctc' sars2.fa|cut -f4-5,7|column -t
strand  start  matched
-       24102  GGTCTC
-       17972  GGTCTC # included in both
-       17329  CGTCTC # included in both
-       9751   CGTCTC
-       2193   CGTCTC
$ seqkit locate -rip'ggtctc|cgtctc' ratg13.fa|cut -f4-5,7|column -t
strand  start  matched
+       11645  ggtctc
+       22919  cgtctc
+       24494  cgtctc
-       17969  ggtctc # included in both
-       17326  cgtctc # included in both
-       10441  ggtctc

People often say that the BsmBI and BsaI sites are ideally spaced for a genetically engineered virus. But the output above shows that the two sites that are shared by both RaTG13 and Wuhan-Hu-1 start at positions 17326 and 17969 in RaTG13. So why would two such nearby sites be kept? But on the other hand the site at 24494 would have been removed and the site at 24102 would have been inserted in its place. And the site at 10441 would be removed but the site at 9751 would be inserted in its place.

In the scenario where a restriction map was built for Wuhan-Hu-1 using RaTG13 as a starting point, the engineers of the virus might have introduced silent mutations to eliminate unwanted recognition sites and to introduce wanted recognition sites, which is why Washburne counted the number of recognition sites in both the source and target sequence. His paper said: "In 2013, researchers constructed a recombinant MERS coronavirus (Scobey et al. 2013). The wildtype virus had a few BglI sites at inconvenient locations, making it poorly amenable to efficient assembly. To construct an idealized MERS-CoV reverse genetic system for IVGA, the researchers removed the existing BglI sites and inserted 6 more evenly spaced BglI sites. All additions/removals were done via synonymous mutations, creating 7 fragments, the longest of which was 5721bp, or 19% the length of the 30kb MERS genome (Fig 2A)."

I don't know why the engineers would need to use both BsaI and BsmBI and not just one of them, like in the case of the reverse genetics system for MERS where only BglI was used. The draft version of the DEFUSE proposal mentioned an order for BsmBI (R0580S and R0580L) but not BsaI: [https://x.com/NestCommander/status/1783112388000256308]

If only BsmBI was used, it would produce only 4 fragments where the longest fragment would be about 12,000 bases long:

$ seqkit locate -rip'cgtctc' sars2.fa|cut -f4-5,7|column -t
strand  start  matched
-       17329  CGTCTC
-       9751   CGTCTC
-       2193   CGTCTC

Washburne's paper says that "the BsaI sites in SARS-COV-2 flank the S1 gene and S1/S2 junction, and a similar design has been used before for substitutions in this region". However it's not right, because there's two BsaI sites, but one of them is about 500 after the S1/S2 junction and the other is about 4,000 bases before the start of S1:

$ seqkit locate -rip'ggtctc,...cggcgg...' sars2.fa|cut -f4-5,7|column -t
strand  start  matched
+       23603  CCTCGGCGGGCA # FCS
-       24102  GGTCTC # BsaI site (about 500 bases after the S1/S2 junction)
-       17972  GGTCTC # BsaI site (about 4000 bases before the start of S1)

An anyway, restriction enzymes are not even needed to manufacture a synthetic coronavirus. Stuart Neil wrote: "With all this talk about restriction enzyme smoking guns, perhaps it's time to admit (oh the shame) that my lab can make coronavirus genomes and mutants thereof without using yeast, bacteria or restriction enzymes. And we can do it over night and rescue the virus in a week." [https://x.com/stuartjdneil/status/1748367338590593116] And another Twitter user wrote: "I hope I'm not being irresponsible when I say that restriction enzymes have been passe for at least a decade now. We reverse engineer viruses weekly using Gibson assembly (fancy PCR). Restriction sites? Pish tosh!!!" [https://x.com/ruby_marchant/status/1748452331887452635] And Billy Bostickson wrote: "Cloning of full genome cDNA in a plasmid is bypassed using the ISA method relying on ex vivo recombination & transcription of viral RNA. Thus, no restriction sites or other genomic modifications are required. https://embopress.org/doi/full/10.15252/embr.202153820" [https://x.com/BillyBostickson/status/1748632049010053569]

Crimes Against Humanity Tour

Matches to Corman-Drosten's primers in SHC014, MA15, and Rs3367

Fleming made this image which showed that Corman-Drosten's RdRp primers matched MA15 and the SARS-CoV-1-like bat viruses SHC014 and Rs3367: [https://www.flemingmethod.com/gain-of-function]

Corman-Drosten's RdRp primer set was designed to match both SARS-CoV-2 and other sarbecoviruses including SARS-CoV. The RdRp primer set has two different probes, where the P2 probe is designed to be specific to SARS-CoV-2 but the P1 probe is a so-called "pan-sarbecovirus" probe that is also designed to match other SARS-like viruses. So it's not surprising that the RdRp primers match the MA15 strain of SARS-CoV-1 and the SARS-CoV-1-like bat viruses SHC014 and Rs3367, because that's what the primers were designed to do.

The figure below shows that Corman and Drosten's primers match various SARS-like viruses like ZC45, SARS-CoV-1, and BM48-31 (even though the E gene primers and probe each have a single mismatch to BM48-31, and the N gene primers and probe have even more mismatches to BM48-31, so the N gene primers and probe might have too many mismatches to yield a positive result for BM48-31): [https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045]

I also don't understand why Fleming claims that MA15 is a "chimera". A chimeric virus is a hybrid of two or more viruses, but MA15 is a mouse-adapted strain of regular SARS-CoV, which was created through serial passage in mice. The paper about MA15 said: "We adapted the SARS-CoV (Urbani strain) by serial passage in the respiratory tract of young BALB/c mice. Fifteen passages resulted in a virus (MA15) that is lethal for mice following intranasal inoculation." [https://pubmed.ncbi.nlm.nih.gov/17222058/] There's a large number of different MA15 sequences at GenBank, but Fleming's screenshot showed the MA15 isolate d30m5, which has only 23 nucleotide changes from the SARS-CoV Urbani sequence at GenBank:

$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=AY278741.1,JF292920.1'|mafft --thread 4 --quiet ->urbanima15.fa
$ seqkit seq -s urbanima15.fa|awk 'NR==1{split($0,a,"");next}{split($0,b,"");d=0;for(i=1;i<=length;i++)d+=a[i]!="-"&&b[i]!="-"&&a[i]!=b[i];print d}'
23

SHC014 and Rs3367 are also not generally known as either chimeric viruses or gain-of-function viruses (even though it's suspicious how SARS-CoV-1-like viruses have many recombination events flanking the NTD and RBM, and it's also strange how Rs3367 is otherwise nearly identical to WIV1 but Rs3367 is missing ORFx and WIV1 is not). Fleming may have confused SHC014 with the chimeric virus described in Menachery et al. 2015, where the spike protein of SHC014 was inserted to an MA15 backbone, because in another version of his graphic I showed above, he had inserted the SHC014-MA15 chimera in place of the regular SHC014. However even in the SHC014-MA15 chimera the RdRp comes from SARS-CoV, so it's not unusual that the RdRp would match Corman-Drosten's primers which were designed to match SARS-CoV.

SHC014 and Rs3367 both have about 95-96% nucleotide identity to SARS-CoV. And in both of them the region of the RdRp that was shown in Fleming's image is 100% identical to the Tor2 reference genome of SARS-CoV:

$ curl -sL sars2.net/f/sarbe.fa.xz|xz -dc>sarbe.fa
$ seqkit grep -nrpTor2,RsSHC014,Rs3367 sarbe.fa|seqkit seq -g|seqkit locate -ip attaagtgagatggtcatgtgtggcggctcactatatgttaaaccaggtggaacatcatccggtgatgctacaactgcttatgctaatagtgtctttaacatttgtcaag|cut -f1,4-6|column -t
seqID        strand  start  end
KC881006.1   +       15356  15465
KC881005.1   +       15356  15465
NC_004718.3  +       15356  15465

In my FASTA file of 529 sarbecovirus sequences, Corman-Drosten's RdRp forward primer has an exact match to 482 sequences:

$ seqkit seq -g sarbe.fa|seqkit stat
file  format  type  num_seqs     sum_len  min_len   avg_len  max_len
-     FASTA   DNA        529  15,673,697   25,965  29,628.9   30,600
$ seqkit seq -g sarbe.fa|seqkit locate -dip GTGARATGGTCATGTGTGGCGG|sed 1d|wc -l
482

And the RdRp reverse primer has an exact match to 444 out of 529 sequences in my file:

$ seqkit seq -g sarbe.fa|seqkit locate -dip CARATGTTAAASACACTATTAGCATA|sed 1d|wc -l
444

Fleming wrote:

By Doing This You Will Find That SARS-CoV-2 Wuhan Hu-1 Matches Three Gain-of-Function (GoF) Viruses Built by Baric and Zhengli Using NIAID and Other Federal Money.
The Three GoF Viruses are:
CoV-RsSHC014
(aka. SARS-CoV-Urbani 2003 & 2016)
SARS-CoV-MA15
SARS-CoV-Rs3367

Fleming also made an image which said: "Matching PCR Primers for SARS-CoV-2 Wuhan-Hu-1 Using Snap Gene Analysis Reveal Matches with SARS-CoV-Rs3367, CoV-RsSHC014 (Urbani) & SARS-CoV-MA15." [https://x.com/Doctor_I_am_The/status/1886410702937641471] I believe he suggested that SHC014 was the same virus as SARS-CoV Urbani. He may have been confused by how Baric's MA15-SHC014 chimera is called "SARS-Urbani-MA_SHC014-spike" at GenBank. [https://www.ncbi.nlm.nih.gov/nuccore/MT308984.1] But MA15 is a mouse-adapted strain of SARS-CoV-1 which is derived from the Urbani strain, and in Baric's chimera the spike protein of the SARS-CoV-1-like bat virus SHC014 was inserted to MA15.

I also don't understand what evidence Fleming has that specifically Rs3367 was "built by Baric and Zhengli" like he wrote. Rs3367 is one of about 50 published SARS-CoV-1-like bat viruses that have around 5-6% nucleotide distance to SARS-CoV-1. I do consider some of the SARS-CoV-1-like bat viruses to have a laboratory origin, and it's suspicious how Rs3367 is otherwise nearly identical to WIV1 except Rs3367 is missing ORFx but WIV1 is not, and there are similarly other branches of SARS-CoV-1-like viruses where ORFx is included in some members of the branch but not others, which is reminiscent of how an ACE2-binding RBM seems to have mysteriously emerged in some closely related SARS-CoV-1-like viruses but not others. [https://academic.oup.com/view-large/figure/232195290/veab007f2.tif] But I haven't seen Fleming explain why he decided to specifically focus on Rs3367.

Fleming also wrote:

All of which raises an interesting question.

We have been thinking about SARS-CoV-2 as a single virus because we have been told it's a single virus; but

What if what we have been calling SARS-CoV-2 isn't a single Gain-of-Function (GoF) Corona Virus leaked out of the Wuhan Lab?

What if it's MORE THAN ONE? Why should we believe that only one GoF virus leaked?

However if other sarbecoviruses would've been in widespread circulation then they would've been detected by metagenomic sequencing, where the total genetic material in a sample is sequenced without having to rely on primers to amplify any specific targeted organism: nopandemic.html#Was_SARS_CoV_2_circulating_in_humans_before_2020_but_not_detected_in_the_same_way_that_HKU1_and_NL63_were_only_discovered_after_SARS1. The NCBI provides a cloud service that makes it possible to search the Sequence Read Archive for sequencing runs with reads that have a k-mer hit to a specific virus like SARS-CoV. A lot of people including me have digged through sequencing runs trying to look for unusual SARS-like viruses, and I have downloaded thousands of SRA runs with k-mer hits for sarbecoviruses, but most of the hits were either false positives or they matched runs from laboratory experiments or projects for sequencing bat viruses, and I haven't found evidence that any other sarbecovirus besides SARS-CoV-2 would've circulated in humans since 2020. In 2021 Chinese researchers found French influenza sequencing runs from 2007-2012 that were contaminated with the lab-created ExoN1 and wtic strains of SARS-CoV-1 (so the runs were probably either contaminated in a laboratory, or there was an outbreak of SARS-CoV-1 in France due a laboratory leak). [https://www.sciencedirect.com/science/article/pii/S2590053621001075] But if SARS-CoV-1-like viruses would've been in any kind of widespread circulation since 2020, then people would've found reads of SARS-CoV-1 at the SRA by using similar methodology that the Chinese researchers used to find the French influenza A samples that were contaminated with SARS-CoV-1. And in general a huge amount of resources was directed to researching sarbecoviruses during COVID, so if other sarbecoviruses would've been in any kind of widespread circulation in humans, they would have certainly been detected.

Fleming also posted a tweet that said: "People did not die because the PCR test wasn't conducted according the the patent. They weren't maimed because of failure to conduct the PCR test pursuant to the patent. They died because of SARS-CoV-Rs3367, CoV-RsSHC014 and SARS-CoV-MA15." [https://x.com/Doctor_I_am_The/status/1843334021629030776] But I don't know how he was confident enough that specifically Rs3367, SHC014, and MA15 were circulating in humans that he was willing to state it as a fact that people died because of those specific viruses. Apart from SHC014 and Rs3367, there are approximately 50 other SARS-CoV-1-like viruses published at GenBank that have around 95% identity to SARS-CoV-1, so how did Fleming know one of them wasn't circulating in humans instead?

Chromosomes of viruses

Fleming said: "In 2001, Ralph Baric at the University of North Carolina gets a patent. It was paid for by National Institutes of Health Research. And its specific goal was organizing chromosomes of viruses. He liked transmissible gastroenteritis virus at the time - it was what he was working on - infectious bronchitis, and coronaviruses." [https://www.flemingmethod.com/gain-of-function, presentation in Phoenix, 15:27]

However viruses obviously don't have chromosomes. Fleming was probably confused by the title of the patent, which was "Directional assembly of large viral genomes and chromosomes", even though it obviously meant "large viral genomes" and "chromosomes of other organisms". [https://patents.google.com/patent/US4683195A/en] The authors of the patent wrote that their method of assembly can be applied to genomes of viruses, or to chromosomes of eukaryotes.

Description of genetic sequencing and PCR testing

Fleming said: "But once you know you have a new virus, what do you do? Well you have to get cell tissue out, like those bronchoalveolar lavages. You clean up the garbage, you get rid of the other material, you get rid of the bacteria, all the mucus, all the garbage that's in there, and you're left with genetic code sequences." [https://www.flemingmethod.com/gain-of-function, part 2 of presentation in Tampa, 11:09] However in the paper by Wu et al. which described the first published genome of SARS-CoV-2, the authors did metagenomic sequencing where they sequenced all genetic material in a sample of bronchoalveolar fluid but they didn't remove human or bacterial genetic material. In their STAT results only about 0.2% of their reads are identified as viral. [https://trace.ncbi.nlm.nih.gov/Traces/?view=run_browser&page_size=10&acc=SRR10971381&display=analysis] About half of their reads consist of only N bases because human reads were masked with N bases for privacy reasons. Supplementary Table 1 of the paper shows that 49 out of 50 of the most abundant MEGAHIT contigs consisted of fragments of the genomes of bacteria. [https://www.nature.com/articles/s41586-020-2008-3#Sec13]

Next Fleming said: "Now frequently it's broken into pieces and you have to put it together like a puzzle. But you can do that just like a puzzle, and that's called Sanger sequencing." But the procedure of assembling the reads like a puzzle is not called Sanger sequencing but it's called genome assembly. Wu et al. used next-generation sequencing and not Sanger sequencing. Sanger sequencing is used only rarely to sequence SARS-CoV-2. The NCBI's Sequence Read Archive has raw reads of about 7 million sequencing runs where the organism is listed as SARS-CoV-2, but I haven't found a single SRA run where Sanger sequencing was used to sequence the entire genome, but I have only found runs where fragments of the virus like a part of the spike protein were sequenced with Sanger sequencing, and Sanger sequencing is sometimes also used to sequence amplicons produced by PCR tests. [https://www.ncbi.nlm.nih.gov/sra/?term=sars-cov-2+%22sanger+sequencing%22]

Next Fleming described PCR testing like this: "And so the spike protein was chosen. And you already saw that we know where the spike protein is in this sequence. And so you look for the beginning of it, and you find about 12 to 18 pieces - amino acids - rather nucleotide bases - that start the spike protein, and that's called the forward primer. And you look for the end of it and you say, well, where's the end? And you look for a roughly 15 to 18 of those, and that's called a reverse primer, which reads the opposite direction." But the spike protein of Wuhan-Hu-1 is 3,822 bases long if you include the stop codon, but typically in PCR tests for SARS-CoV-2 the distance between the forward and reverse primers is only about 100 to 200 bases. The forward and reverse primers don't have to be located at opposite ends of the same gene or even within the same gene. Also PCR primers are almost always longer than 12 bases. In PCR tests for detecting SARS-CoV-2, the length of the primers typically ranges from 18 to 26 bases.

Book Is COVID-19 a Bioweapon

This section deals with Fleming's book "Is COVID-19 a Bioweapon?: A Scientific and Forensic Investigation". [http://libgen.li/index.php?req=richard+fleming+bioweapon]

Chimeric sequence from 2006 with a segment labeled SARS-CoV2

Fleming wrote:

In 2006, using chimeric (Gain-of-Function) research, Chinese scientists reported their ability to combine parts of four different viruses into a single viral genome.[16] This report raises a few serious questions in my mind.

First, why were these researchers combining parts of four dangerous viruses - specifically, hepatitis C virus (HCV), human immunodeficiency virus -1 (HIV-1), SARS-CoV-1 (identified as SARS-CoV-1 and not SARSCoV), and SARS-CoV-2?

Second, if as we've been told, SARS-CoV-2 didn't appear until 2019 and there were no identified naturally occurring SARS-CoV-2 reported between this 2006 publication and 2019, then doesn't this at least in part suggest that SARS-CoV-2 is not naturally occurring but man-made?

Third, if the answer to question number two is that the virus is manmade, going as far back as 2006, then doesn't this add credence to those who have cautioned that SARS-CoV-1 was a bioweapon and SARS-CoV-2 is an upgraded version of that bioweapon?

However in the paper he referred to, the authors used "SARS-CoV1" and "SARS-CoV2" as names of two segments of SARS-CoV-1 they inserted into a 1,200-base chimeric RNA sequence. The paper said: "Because most commercial armored RNA preparations contain exogenous sequences of <500 nucleotides, separate armored RNA species are often prepared for calibration of each target in multiple virus assays. To reduce costs and simplify multivirus detection, we are seeking to produce a single chimeric armored RNA species that might be used as a positive control for multiple viral targets. We consider this task to be feasible because the inventors of armored RNA predicted that, theoretically, at least 2 kb of nonbacteriophage RNA sequence might be encapsulated. As proof of this principle, we tried to directly package a 1200-nucleotide-long foreign RNA sequence containing gene fragments of hepatitis C virus (HCV), HIV-1, severe acute respiratory syndrome coronavirus 1 (SARS-CoV1), and SARS-CoV2 into the original armored RNA production vector pAR-1." [https://pmc.ncbi.nlm.nih.gov/articles/PMC7542541/]

The full chimeric sequence is shown in the supplementary document file:

The formatting of the document was screwed up, but text at the top says that the segment labeled "SARS-CoV2" was 190 bases long, so you can tell it refers to the segment that was highlighted in gray at the bottom. It is identical to bases 18,153 to 18,342 of the Tor2 reference genome of SARS-CoV:

$ curl -s 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=NC_004718.3'>sars1.fa
$ seqkit locate -pATGAATTACCAAGTCAATGGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCTGTCATGCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTATG sars1.fa|cut -f1,4-6|column -t
seqID        strand  start  end
NC_004718.3  +       18153  18342

Fleming later referred to the same paper again when he wrote: "While most people believe that SARS-CoV-2 first appeared in 2019, evidence shows the virus responsible for the InflammoThrombotic disease known as COVID-19 was being manipulated two provinces from Wuhan in 2006, and the work continued forward.[34] Those initial genetic sequences are shown in the appendix." However I guess he didn't actually bother checking if the genetic sequence in the appendix matched SARS-CoV-2 or the original SARS-CoV.

There's also a paper from 2007 where the authors constructed a 2,248-base chimeric RNA sequence which included three different segments from SARS-CoV, which the authors referred to as "SARS-CoV1", "SARS-CoV2", and "SARS-CoV3". The paper said: "An exogenous chimeric sequence 2,248 bp in length comprising the following sequences was inserted into a pACYCDuet-1 plasmid (p15A-type replication origin; Novagen): M-300 (nt 17∼373, 357 bp from avian influenza virus matrix gene; GenBank accession no. DQ864720), SARS-CoV1 (nt 15224 to 15618, 395 bp from SARS-CoV; GenBank accession no. AY864806), SARS-CoV2 (nt 18038 to 18340, 303 bp from SARS-CoV; GenBank accession no. AY864806), SARS-CoV3 (nt 328110 [sic; should be nt 28110] to 28692, 583 bp from SARS-CoV; GenBank accession no. AY864806), a pac site (19 bp), HCV (nt 18 to 310, 293 bp from HCV 5'UTR; GenBank accession no. AF139594), and HA300 (nt 295 to 611, 317 bp from H5N1 avian influenza virus; GenBank accession no. DQ864720)." [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2395109/] The three segments of SARS-CoV-1 were taken from a sequence for the SARS-CoV-1 isolate BJ202 that was submitted to GenBank in 2004. [https://www.ncbi.nlm.nih.gov/nuccore/AY864806]

Was the WIV database wiped in the summer of 2019?

Fleming wrote: "During the summer of 2019, the Wuhan Institute of Virology genetic databank records, including its viral genomes and research, were wiped - months before the recognition of the emergence of SARS-CoV-2."

However DRASTIC's paper about the database said that the website of the database became inaccessible on September 12th 2019 in an unspecified timezone (which would usually be considered fall and not summer). And if the website was inaccissible, it doesn't mean that the database employed by the website was wiped, because later the website became intermittently accessible again: [https://www.researchgate.net/publication/349073738_An_investigation_into_the_WIV_databases_that_were_taken_offline]

Batvirus.whiov.ac.cn had been online for a few years, saw a version 2 released in June 2019, went inactive for a week during the second half of August 19, before becoming definitely inaccessible (out of the WIV at least) on the 12th Sep 19. It was online intermittently after this date from mid-December 2019, and occasionally until February 2020, but was not accessed from outside of the WIV after 12 September 2019.

Claim that Mullis did not use more than 15 to 20 cycles with PCR

Fleming wrote:

Patent number 4,683,195 was granted to Mullis and others for "a process for detecting the presence or absence of at least one specific nucleic acid sequence in a sample containing a nucleic acid or mixture of nucleic acids."

A clear review of this patent shows that Mullis did not exceed fifteen to twenty cycles of PCR for the identification of genetic material.

However the table appears to simply demonstrate how the number of copies produced by PCR doubles each cycle, so it's not an indication of how many PCR cycles Mullis used himself during various workflows.

The text of the patent by Mullis said: "If the sample is human genomic DNA, preferably the number of cycles is from about 10-30." [https://patents.google.com/patent/US4683195A/en]

A paper from 1988 where Mullis was the corresponding author said that the authors used 60 cycles during one workflow: "Fifteen 1-μg samples of the 10-6 dilution of MOLT4 DNA in GM2064 DNA prepared previously (Fig. 2) were amplified for 60 cycles with 55°C annealing, and the primers RS79 and RS80." [http://sci-hub.ee/https://www.science.org/doi/10.1126/science.2448875, https://x.com/TakethatCt/status/1793390427594240368] And another part of the paper said: "Samples of human genomic DNA were subjected to 20 to 35 cycles of PCR ampification with optimal amounts of either Klenow or Tag DNA polymerase and analyzed by agarose gel electrophoresis (Fig. 1A) and Southern hybridization (Fig. 1B)."

Claim that SARS-CoV-1 is unable to bind human ACE2

Fleming wrote:

In 2010, Shi Zhengli conducted chimeric research on SARS-CoV-1 (then called SARS-CoV), including combining HIV-pseudovirus to look at the binding capacity of this virus with human ACE2 receptors. Their work specifically included altering (through mutagenesis) the spike proteins to determine how to increase the spike protein binding to the ACE2 receptor.

The research showed no proline-arginine-arginine-alanine (PRRA) insert critical to the binding of the SARS-CoV-2 to ACE2 receptors on human cells. As noted in this published research (jointly done by Dr. Zhengli at the Wuhan Institute of Virology, researchers in Australia, and the University of Minnesota Medical School), not only is the spike protein from horseshoe bats unable to bind to ACE2 receptors, but also these differences along with differences in civets highlight a critical missing piece to the zoonotic theory of the original of SARS-CoV-2:

However, although the genetically related SARS-like coronavirus (SL-CoV) has been identified in horseshoe bats of the genus Rhinolophus [5, 8, 12, 18], its spike protein was not able to use the human ACE2 (hACE2) protein as a receptor. Close examination of the crystal structure of human SARS-CoV RBD complexed with hACE2 suggests that truncations in the receptor-binding motif (RBM) region of SL-CoV spike protein abolish its hACE2-binding ability [7, 10], and hence the SL-CoV found recently in horseshoe bats is unlikely to be the direct ancestor of human SARS-CoV.

Also, it has been shown that the human SARS-CoV spike protein and its closely related civet SARS-CoV spike protein were not able to use a horseshoe bat (R. pearsoni) ACE2 as a receptor [13], highlighting a critical missing link in the bat-tocivet/human transmission chain of SARSCoV. [Emphasis added [by Fleming].]

However the paper he quoted said that other studies had found that various SARS-like bat viruses were not able to use human ACE2 as a receptor, and next it said that SARS-CoV-1 was not able to use bat ACE2 as a receptor. But the paper he quoted did not say anywhere that SARS-CoV-1 was not able to use human ACE2 as a receptor. [https://pmc.ncbi.nlm.nih.gov/articles/PMC7086629/]

ACE2 binding ability is not even determined by the FCS insert like Fleming suggested but by the RBD, because cleavage by furin occurs at a later step after the virus has already bound to the ACE2 receptor. And in the case of SARS-CoV-2, the receptor binding domain means the ACE2 binding domain. ChatGPT said that the procedure of viral entry to a human cell consists of these steps:

  1. Spike protein on virus binds to the ACE2 receptor on human cells via the S1 subunit.
  2. Conformational change occurs in the spike protein after ACE2 binding.
  3. Furin cleavage of the spike protein between the S1 and S2 subunits primes the virus for entry.
  4. Secondary cleavage by TMPRSS2 or cathepsins activates the spike protein, exposing the fusion peptide.
  5. Membrane fusion is mediated by the S2 subunit, allowing viral RNA to enter the host cell.
  6. Viral RNA release into the host cell cytoplasm initiates infection.

Claim that the S1 subunit is more stable than the S2 subunit

Fleming wrote: "The furin cleavage site lies in the stable part of the spike protein - the S1 component. All of the mutations being seen in SARSCoV-2 are occurring in the S2 component." He has elsewhere also said that S2 is a more variable region than S1, even though in reality it's of course the other way around.

In Wuhan-Hu-1, S1 is generally considered to extend from amino acid 1 to 685 and S2 is considered to extend from amino acid 686 until the end of the spike protein. The last R of RRAR is at position 685.

In NextStrain's subsample of about 5,000 sequences of SARS-CoV-2, about 87% of all amino acid changes in the spike protein were within the range of 1 to 685: [https://docs.nextstrain.org/projects/ncov/en/latest/reference/remote_inputs.html]

$ curl https://data.nextstrain.org/files/ncov/open/global/metadata.tsv.xz|xz -dc>global.tsv
$ sed 1d global.tsv|cut -f57|tr , \\n|grep ^S|sed 's/...//;s/.$//'|awk '{s1+=($0<=685)}END{print s1/NR}'
0.873935

Pradhan's uncanny HIV inserts

Fleming referred to a paper by Zhang et al. which criticized Pradhan's paper, and he wrote:

The investigators concluded that three of the four inserts are present in other coronaviruses:

Among the 4 "insertions" (ISs) of the 2019-nCoV, IS1 has only 1 residue different from the bat coronavirus, and 3 out of 7 residues are identical with MERS-CoV. IS2 and IS3 are all identical to the bat coronavirus. For IS4, although the local sequence alignment by BLAST did not hit the bat coronavirus in Table 4, it has a close evolutionary relation with the bat coronavirus in the MSA. In particular, the first 6 residues in the IS4 fragment "QTQTNSPRRA" from 2019-nCoV are identical to the bat CoV, while the last 4 residues, which were absent in the bat coronavirus or SARS-CoV, have at least 50% identity to MERS-CoV and HCoV-HKU1 34 [Emphasis added [by Fleming].] [34]

Taken together, these statements from research paid for by NIAID (AI134678) and the National Science Foundation (DBI1564756, 1IS1901191) - both agencies involved in the funding of Daszak, Baric, and Zhengli Gain-of-Function research - appear to confirm both Dr. Li-Meng Yan's assertion that SARS-CoV-1 was the first bioweapon and that SARS-CoV-2 is the advanced version noting the PRRA segment.

I don't understand how Fleming concluded based on the paper he quoted that "SARS-CoV-1 was the first bioweapon". If motifs similar to Pradhan's inserts are missing from SARS-CoV-1 but present in RaTG13, MERS, or HKU1, then how does that show that SARS-CoV-1 was artificially engineered? Was SARS-CoV-1 engineered to remove Pradhan's inserts?

Fleming didn't mention that by the "bat coronavirus", the authors he quoted referred to RaTG13, which is identical to Pradhan's second and third matches and differs by only one residue to Pradhan's first match. RaTG13 was not mentioned by Pradhan et al., because their paper was published at bioRxiv only 2 days after RaTG13 was published at GenBank. A major omission in Pradhan's paper was that it didn't mention ZC45 and ZXC21, which had already been published in 2018, and where the regions of the first 2 so-called inserts are similar to SARS-CoV-2.

I wrote about Pradhan et al. here: pradhan.html. Pradhan identified the locations of the so-called inserts by doing a pairwise alignment of SARS-CoV-2 against SARS-CoV-1, so you couldn't tell if the gaps in Pradhan's pairwise alignment were insertions in SARS-CoV-2 or deletions in SARS-CoV-1. Pradhan's first so-called insert actually looks more like a deletion in SARS-CoV-1. When I used a more accurate method to determine the positions of the gaps by doing a multiple sequence alignment of SARS-CoV-2 against a diverse set of sarbecoviruses, the gaps near the second and third so-called inserts were placed at different spots than in Pradhan's paper, so it looked like Pradhan's second and third inserts were not inserts at all, but the real second insert was after the motif identified by Pradhan and the real third insert was before the motif identified by Pradhan.

From Pradhan's pairwise alignment, it looked like SARS-CoV-2 had the insert YYHK relative to SARS-CoV-1:

But the next image shows that two residues after the YYHK, SARS-CoV-2 has the residues KSW which are shared by the European and African sarbecoviruses at the bottom of the image, but after the KSW SARS-CoV-2 has the insert MESEFR that is missing from the European and African viruses. So the real insert rather seems like MESEFR and not YYHK:

Pradhan didn't report the E-values of his BLAST matches anywhere, which would've shown how many similarly close or closer matches are expected to occur by chance, but all of his matches had a high E-value.

The regions near Pradhan's so-called inserts also had similarly close or closer matches to many other species of viruses and not only HIV-1, and HIV-1 wasn't even the best match for some of the inserts, but the reason why Pradhan focused on HIV-1 was that HIV-1 happened to be included on the list of top matches for all four of the so-called inserts. But that's because in January 2020 when Pradhan did his BLAST searches, HIV-1 and influenza A were the two species of viruses with the most sequences published at GenBank, so even if you would've searched for a random sequence of amino acids against a database of viruses, the top 100 or so matches would've likely included matches to HIV-1.

There's hundreds of thousands of HIV protein sequences that had been published at GenBank before 2020, but Pradhan's matches to the so-called inserts only occur in a couple of the sequences. Pradhan's matches to the first two so-called inserts are both 6 aa long. The match to the first so-called insert occurs in a set of 10 similar sequences from Thailand, but in none of the other hundreds of thousands of sequences. The match to the second so-called insert occurs in a single sequence from Kenya, but in none of the other hundreds of thousands of sequences. None of Pradhan's matches occur in the reference genome of HIV-1.

There are 6 aa segments that match HIV throughout the genome of SARS-CoV-2, and not only at the spots that looked like insertions in Pradhan's alignment.

If you generate a random sequence of 6 amino acids, its best match to the reference genome of HIV-1 will usually have a 3 out of 6 aa match. So in order to turn it to a 6 out of 6 aa match, you need to have 3 aa changes within a 6 aa segment from the reference genome of HIV. The reference genome was collected in 1983, but in the more stable regions of the genome, even samples from the 2020s still have fairly long stretches of amino acids that are identical to the reference genome. But in the hypervariable regions, it's common to have multiple amino acid changes within a 6 aa segment. So if you generate a bunch of random 6 aa segments, and you pick the segments that have nonzero perfect matches within the set of HIV protein sequences published before 2020, the segments are likely to match the hypervariable regions.

Furin cleavage motif in HIV is not PRRA

Fleming wrote: "furin (PRRA) cleavage is responsible not only for increasing the infectivity of SARS-CoV-2 but also for converting HIV gp160 to gp120 and gp41".

The motif cleaved by furin in Wuhan-Hu-1 is RRAR and not PRRA, but the P is just part of the 12-base insert which added the furin cleavage site.

You can look up features in the envelope protein of HIV-1 from this spreadsheet: https://www.hiv.lanl.gov/content/sequence/HIV/MAP/Env_features.xlsx. It shows that in the HXB2 reference genome of HIV-1, the furin cleavage motif is REKR:

The Los Alamos National Laboratory has published an HIV subtype reference collection, which contains 555 sequences of HIV and SIV, with up to 5 sequences from each subtype of HIV. I downloaded envelope protein sequences from the subtype reference here: https://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html (switch alignment type to "Subtype reference", change "DNA/Protein" to "Protein", and click "Get Alignment"). In 475 out of 555 sequences, the motif cleaved by furin was REKR, and the next most common motifs at the same spot of the alignment were RQKR or RERR:

$ wget sars2.net/f/HIV1_REF_2023_env_PRO.fasta
$ seqkit seq -s HIV1_REF_2023_env_PRO.fasta|cut -c675-678|sort|uniq -c|sort -r
    475 REKR
     17 RQKR
     14 RERR
      9 RGKR
      8 RDKR
      7 KEKR
      5 RSKR
      4 RKKR
      3 RSRR
      3 IEKR
      2 RAKR
      1 RNKR
      1 RHKR
      1 RGER
      1 REK*
      1 KKKK
      1 GEKR
      1 -EKR
      1 ----

Perez and Montagnier's BLAST matches to HIV

Fleming wrote that Luc Montagnier had found a 1,770-base insertion matching HIV-1 in the spike protein of SARS-CoV-2:

Finally, we turn our attention to Luc Montagnier - the discoverer of the Human Immunodeficiency Virus (HIV). Montagnier has published one paper and has submitted another for consideration. In both of these papers, Montagnier utilizes the same BLAST technology for analysis of the genetic code of SARS-CoV-2.

He notes eighteen RNA fragments similar to HIV or simian (higher primates) that have the potential to change the genetic expression of COVID-19:

18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID-19 genome. These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE. These EIE are not dispersed randomly, but are concentrated in a small part of the genome.

This is shown schematically in the figure found on page XXX in the insert.

As stated so eloquently by Montagnier, the spike protein not only has the PRRA insertion (twelve nucleotide bases) but also a 1770 nucleotide base (590 amino acid) insertion matching HIV-1:

We have studied the most recent genetic evolution of the COVID-19 strains involved in the world epidemic. We found a significant occurrence of mutations and deletions in the 225 bases area.

On sampling genomes, we show that this 225 bases key region of each genome, rich in EIE, and the 1770 bases SPIKE region evolve much faster than the corresponding whole genome (cases of 44 patients' genomes from WA Seattle state, original epicenter in USA).

In the comparative analysis of both SPIKES genes of COVID-19 and Bat RaTG13 we note two abnormal facts:

  1. The insertion of 4 contiguous PRRA amino acids in the middle of SPIKE (we show that this site was already an optimal cleavage site BEFORE this insertion).
  2. An abnormal distribution of synonymous codons in the second half of SPIKE." Finally we show the insertion in this 1770 bases SPIKE region of a significant pair of EIEs from Plasmodium Yoelii and of a possible HIV1 EIE with a crucial Spike mutation.

I believe Montagnier made close to no contribution to the paper he coauthored with Jean-Claude Perez, so I'm referring to the author of the paper as simply Perez.

Fleming misunderstood what Perez meant by the 1,770-base region of the spike protein. The region wasn't an HIV-like insertion in SARS-CoV-2 that was missing from other sarbecoviruses, but a region where SARS-CoV-2 had high similarity to RaTG13: [https://www.granthaalayahpublication.org/journals/granthaalayah/article/view/IJRG20_B07_3568]

Pezez's 1,770-base region started after the RRAR and extended to the end of the spike protein, so the region was identical to the S2 subunit of the spike protein. In the next plot where I compared Wuhan-Hu-1 against RaTG13, the black rectangle shows that there's only 3 amino acid changes in the S2 region, because there's only 3 steps up in the line for nonsynonymous mutations, which is what Perez meant by the high similarity between RaTG13 and SARS-CoV-2:

In one of his presentations, Fleming said: "Luc Montagnier - who was a friend of mine, passed away on the 8th of February - he and Jean-Claude Perez did this work to show the HIV and SIV inserts that they found. PRRA, four proteins, each one has three nucleotide bases. That's 12 nucleotide bases. They found 1,770-nucleotide-base inserts. That's not naturally occurring. They occur one nucleotide base at a time." [https://www.flemingmethod.com/gain-of-function, video from Phoenix, 43:48] But again, Perez's 1,770-base region is not an insert, but it consists of the entire S2 subunit of the spike protein. And PRRA does not consist of 4 proteins but 4 amino acids.

Perez's paper is even more awful than Pradhan's paper. [pradhan.html#Perez_and_Montagniers_paper_about_BLAST_matches_to_HIV] Perez used nucleotide BLAST instead of protein BLAST like Pradhan, but he forgot to exclude matches that were on the wrong strand or wrong frame, which caused most of his matches to be meaningless because they don't code for the same amino acids in HIV and SARS-CoV-2. Perez identified a 955-base region of SARS-CoV-2 that supposedly had a high density of BLAST matches to HIV and SIV, and 15 of the matches were shown in his Table 1. He didn't show the strand or frame of the matches anywhere, but 10 of the matches are on the wrong strand, and 2 of the remaining 5 matches are in the wrong frame. Perez deceptively didn't report the E-values of the matches, which would've indicated how many similarly close or closer matches were expected to occur by chance, but when I did a BLAST search of his 955-base region against sequences of HIV published before 2020, the E-values of the 15 matches ranged from about 1.4 to 2604, so the E-values didn't get even close to reaching below the significance level of 0.05:

Subject E-value Percentage
identity
Length Mism-
atches
Strand SC2
frame
HIV
frame
Right strand
and frame
JN230738.1 HIV-2 isolate 56 from France envelope glycoprotein (env) gene, partial cds 746 100.000 16 0 + 0 1 no
MF373163.1 HIV-1 isolate 060SE from Sweden, partial genome 1.4 100.000 21 0 - no
JN863831.1 HIV-2 isolate CA65410.13 from Guinea-Bissau envelope gene, partial cds 2604 94.444 18 1 - no
KR862351.1 Simian immunodeficiency virus isolate VSAA2001, complete genome 61 95.238 21 1 - no
EU875177.1 HIV-1 clone ML1592n from Kenya nonfunctional vpu protein (vpu) gene, complete sequence; and
nonfunctional envelope glycoprotein (env) gene, partial sequence
5.0 87.500 32 4 - no
JF267434.1 HIV-2 isolate 05HANCV37 from Cape Verde envelope glycoprotein (env) gene, partial cds 61 100.000 18 0 + 1 1 yes
KJ131112.1 HIV-2 isolate 106CP_RT from Cote d'Ivoire reverse transcriptase gene, partial cds 214 95.000 20 1 - no
AF003044.1 Simian immunodeficiency virus isolate P18 patient P1, gp120 (env) gene, partial cds 214 95.000 20 1 + 1 1 yes
JN091691.1 Simian immunodeficiency virus isolate TAN5 from Tanzania, complete genome 214 90.909 22 2 - no
HQ644953.1 HIV-1 isolate 19828.PPH11 from Netherlands envelope glycoprotein (env) gene, partial cds 5.0 89.286 28 3 + 0 0 yes
L07625.1 Human immunodeficiency virus type 2 complete genome from strain HIV-2UC1 746 84.615 26 4 + 2 1 no
JF811228.1 HIV-2 isolate H2A62_111808_CINT_WBC_25 from Senegal pol gene, partial sequence 746 100.000 16 0 - no
KC187066.1 HIV-1 isolate 4045_Plasma_Visit1_amplicon9 from Malawi envelope glycoprotein (env) gene, complete cds 2604 90.000 20 2 - no
GU481454.1 HIV-1 isolate 07.RU.SP-R497.VI.F5 from Russia envelope glycoprotein (env) gene, complete cds 5.0 82.051 39 5 - no
LM999945.1 Simian immunodeficiency virus partial pol gene for Pol, isolate SIVagmTAN-CM545-pol 214 83.333 30 5 - no

For example from the second row of my table above, you can see that there's a 21-base segment of SARS-CoV-2 that has a perfect match to a Swedish HIV sample from 2017. [https://www.ncbi.nlm.nih.gov/nuccore/MF373163] But the matches to SARS-CoV-2 and HIV are on the opposite strands, so the amino acid translations of the matches are completely different:

SARS-CoV-2:                Swedish HIV sequence:
                            <--------------------
 -------------------->      TACGAAGTCTACTACTGCGTA # reversed version of segment matched in SARS-CoV-2
 ATGCGTCATCATCTGAAGCAT      ATGCTTCAGATGATGACGCAT # reversed version with complemented bases
AATGCGTCATCATCTGAAGCATTT   TATGCTTCAGATGATGACGCATAT
 N  A  S  S  S  E  A  F     Y  A  S  D  D  D  A  Y

And even the perfect 21-base match had an E-value of about 1.4, which means that about 1.4 similarly close or closer matches were expected to occur by chance between Perez's 955-base region and the set of HIV sequences that had been published before 2020. The E-value is directly proportional to the length of the query sequence, so the E-value would've been about 30 times higher if I would've searched for the entire 29,903-base genome of SARS-CoV-2 and not only Perez's 955-base region.

Perez incorrectly considered matches with a length of 18 bases or more to be significant, regardless of how many mismatches he got. But even the perfect 21-base match was nowhere close to having an E-value below the significance level of 0.05.

I suspect Perez is intentionally producing disinformation, because he has also said that vaccinated people are harboring 5G-activated nanopathogens, that vaccinated people have MAC addresses, that vaccines contain graphene oxide, and that the pandemic was fake: [https://x.com/JCPEREZCODEX/status/1875105196294201653, https://x.com/JCPEREZCODEX/status/1768971965178548510, https://x.com/JCPEREZCODEX/status/1686762168606167040, https://x.com/JCPEREZCODEX/status/1655898773774647303, https://x.com/JCPEREZCODEX/status/1671902292402995200]

Collaboration with Slovakian commission

Soňa Peková and ALLATRA

In March 2025, Fleming published a PDF document by Soňa Peková which summarized her analysis of DNA contamination in vaccines. [https://www.10letters.org/CzechResearch.pdf] In May 2025, Fleming posted a preprint about the analysis on his website, where the authors were listed as Richard Fleming, Peter Kotlár, and Soňa Peková. [https://www.fmtvdm.com/_files/ugd/659775_4f73f98b60ae4438bd343c21f2cfc79c.pdf]

Peter Kotlár has the impressive-sounding title of a "plenipotentiary", but it just means that he is a Slovakian MP who was appointed to run a parliamentary commission on COVID. One Slovakian MP said that Kotlár's appointment was a bad joke, and another MP compared it to the recent appointment of a poacher as the head of a Slovakian national park. [https://www.novinky.cz/clanek/zahranicni-evropa-odpurce-ockovani-kotlar-bude-na-slovensku-vysetrovat-management-pandemie-40457747]

Kotlár hosted a conspiracy show called Televízia Slovan together with Martina Šimkovičová, who previously worked as a newscaster on mainstream TV. In 2023 both hosts of the conspiracy show managed to get elected to the Slovakian parliament, and Šimkovičová was appointed as the culture minister of Slovakia. Videos by Kotlár's commission were posted on Šimkovičová's Facebook page, but they were later made private. [https://www.facebook.com/martina.peter.111/videos/] I found only two western people who did presentations for the commission, who were Richard Fleming and Charles Rixey:

In 2020 Soňa Peková was reported to face up to 10 years in prison for medical insurance fraud. [https://archiv.hn.cz/c1-66808150-lekarka-pekova-pujde-s-janouskem-pred-soud-kvuli-machinacim-s-pojistovnami-skoda-podle-zaloby-cini-240-milionu] She was acquitted in 2022 and did not serve time in prison. [https://ct24.ceskatelevize.cz/clanek/domaci/soud-zprostil-obzaloby-lobbistu-janouska-i-dalsi-ctyri-lidi-v-kauze-spolecnosti-chambon-23287]

By 2023 Peková had joined a neo-Theosophical cult called ALLATRA, even though I don't know if it's related to her criminal charges or not. [https://x.com/search?q=sona+pekova+allatra+until%3A2024-7-1&f=live] In 2023 she presented genetic evidence that Slavs are the oldest ethnic group after the fall of Atlantis. [https://cz24.news/video-molekularni-geneticka-mudr-pekova-o-genetice-nasich-predku-slovanu-jako-nejstarsim-etniku-po-padu-atlantidy-sile-a-vyjimecnosti-slovanu/] In a video in 2024, Soňa Peková talked about the Pleiadians and how contact with aliens is a win-win situation, and she also said that Gaia has the capacity to reach up to 9D reality and not only 5D reality, even though it's possible that vaccinated people cannot move to a higher dimension. [https://www.podtatransky-kurier.sk/galaxia/sona-pekova-gaia-ma-byt-az-9d]

ALLATRA says that the world will end in the year 2036, they promote theories about ancient aliens and 5D ascension, and they say that Draconian reptilians have a goal of enslaving humanity. [https://infosecurity.sk/zahranicne/sona-pekova-preslavila-sa-dezinformaciami-o-covid-19-v-sucasnosti-ma-blizko-k-ezoterickej-sekte/] A member of ALLATRA called Zhanna is allegedly an Anunnaki who makes TikTok videos from a space station. The primary book of ALLATRA is presented as a dialogue between the author of the book and the ascended master Rigden Djappo, who is a mythical character invented by the Russian Theosophist Nikolas Roerich.

ALLATRA is overtly based in Ukraine, but they run a multilingual media operation that produces conspiracy content in various languages, and much of ALLATRA's content is initially released in English but then translated to various Slavic languages. It is reminiscent of the multilingual media empires operated by the Unification Church, Falun Gong, and Miles Guo's cult. All three cults are based in New York even though they primarily target East Asian countries, and the leaders of all three cults moved from an East Asian country to New York to run the cult. But ALLATRA looks like a version of Falun Gong that is targeted against Eastern European countries instead of China.

ALLATRA's international representative is Egon Cholakian, who has an impressive bio where he claims that he is an intelligence expert who studied under Henry Kissinger, and that when he resided in Iran he had a close working relationship with the head of the CIA, and that he was a founding member of the OSINT Foundation. [https://earthsavesciencecollaborative.com] However his bio might be largely made up, and I didn't find it corroborated by outside sources.

Egon Cholakian's website used to have an AI-generated photo where he posed together with the Nobel laureate Robert Merton, but if you zoomed in on a background, the backs of books on a bookshelf didn't have any legible text, and there were photos on the bookshelf where people were missing faces. [http://web.archive.org/web/20240717153504/earthsavesciencecollaborative.com/assets/slider/13.jpg?t=1]

ALLATRA has a YouTube channel that consists of AI-generated videos that employ the avatar of Egon Cholakian:

In one of the AI-generated videos that employed the avatar of Egon Cholakian, Cholakian said that "The claim by Russian media that I am a deep fake is so absurd it would be laughable if it weren't part of a larger coordinated effort to mislead you." [https://www.youtube.com/watch?v=J_EM0Dp2Cmg&t=1m46s] In another video he called himself a "specialist in intelligence and disinformation". [https://www.youtube.com/watch?v=Q2GVN5Hj16Y&t=18m30s] In the same video he also said that Scientology was an "international pro-democratic organization", and that Scientology was unjustly persecuted in Russia. [1:32:47]

ALLATRA claims that they are not a cult, but they made an 8-hour documentary film about how the anti-cult movement is the root of all the world's evils, and the anti-cult movement is the power behind Putin's throne, and the anti-cult movement did 9/11, and the anti-cult movement is secretly orchestrating school shootings. [https://www.youtube.com/watch?v=4l4CAqW1B2g&t=21060s] The film also included a long segment about how Falun Gong was persecuted in China.

The secular arm of ALLATRA is known as the Creative Society, which ALLATRA aims to one day make into the governing body of the world. The emblem of the Creative Society looks similar to the emblem of the Theosophical Society, except the head of the snake has been replaced with an arrowhead, the star of David has been replaced with a triangle, the ankh has been replaced with a Moebius strip, and the swastika and Hindu AUM symbol have been removed:

The Creative Society has developed a "comprehensive mathematical and tectonophysical model of contemporary changes occurring on earth". [https://creativesociety.com/climate-model] The term "earth changes" was coined by the Theosophical guru Edgar Cacey. ALLATRA made a video about a 12,000-year cataclysmic pole shift cycle, which said that Vladimir Vasilievich Bubnenkov had found that there was a "Great Cycle of the change of epochs lasting 11,911 years", and that Alexander Mikhailovich Baturin had found that "The planet Earth periodically turns over in space by 360 angular degrees, which causes the cyclical nature of global events - global catastrophes with a frequency of 12,166 years." [https://www.youtube.com/watch?v=-IIoMfBK10g&t=4m5s] However in reality the length of the precessional cycle is about 25,771 years, so half of a cycle is closer to 13,000 than 12,000 years. The concept of a 12,000-year cycle appears to have been introduced in the late 1800s by Swami Sri Yukteswar, who presented an alternative interpretation of the length of the Indian yuga cycles, which later influenced Theosophical cosmology. [https://en.wikipedia.org/wiki/The_Holy_Science] In another video about the 12,000-year disaster cycle, ALLATRA also promoted Edgar Cacey's claim that the Great Pyramid of Giza is about 12,500 years old, which was later copied by Graham Hancock. [https://www.youtube.com/watch?v=-IIoMfBK10g]

In the same way Scientology is allied with the Nation of Islam, ALLATRA is allied with an African American freemasonic lodge called the World's Masonic United Nations. The Facebook page of Creative Society features a speech by the Most Puissant Sovereign Grand Commander of the World's Masonic United Nations, who said that the world's strongest foundation is the Eight Pillars of Creative Society, and he said that "we support the Creative Society project and we will use all legal and peaceful means to implement this ideal as broadly and quickly as possible": [https://www.facebook.com/watch/?v=264451399321129]

Soňa Peková wrote in Czech that humans have to find peace within themselves, "So that we can start building a new society as quickly as possible, based on the principles of humanity, solidarity, generosity, equality and belonging." [https://www.facebook.com/story.php?story_fbid=122184364922255070&id=61557652117076] She used the same Czech word for "society" that is used in the Czech name for Creative Society. So by building a new society, she might have referred to the Creative Society, which is the organization that ALLATRA aims to establish as the governing body of the world, so that one day the world will be ruled by ALLATRA. [https://creativesociety.com/about-the-project]

Similar to Scientology and Nation of Islam, ALLATRA is also concerned with the topic of autism, except ALLATRA says that autism is caused by microplastics and not by vaccines. [https://www.facebook.com/CreativeSociety.en/videos/1206675507639876]

Statement by Slovak Academy of Sciences

The Slovak Academy of Sciences published the following statement about the paper by Richard Fleming, Peter Kotlár, and Soňa Peková: [https://www.sav.sk/?lang=sk&doc=services-news&source_no=20&news_no=12787, translated]

The Slovak Academy of Sciences is responding to a publication published in the HSOA Journal of Angiology and Vascular Surgery, co-authored by the Slovak Government's Plenipotentiary for Review of the Resource Governance and Management Process during the COVID-19 pandemic, Peter Kotlár.

The Slovak Academy of Sciences is following with interest the attempts to re-analyze vaccines that have been analyzed many times. However, the published publication does not adequately describe the methods, lacks controls, and does not clearly define the input quantities of material. The published claims are not confronted with existing knowledge or other methods, which is necessary given the seriousness of the findings presented.

The title of the publication suggests a quantitative analysis, but the results are not compared to the prescribed and strictly controlled quantitative limits of residual DNA, and estimated numbers of molecules are given, which can be misleading. Strong conclusions are not supported by sufficiently strong data.

The scientific shortcomings of the aforementioned publication reflect the fact that the journal in which it was published is classified as a predatory journal. This particular journal does not meet even basic quality criteria, is not registered in recognized databases, has a very short review process and unclear review procedure, and does not have defined basic rules for presenting results and methodologies.

The Slovak Academy of Sciences strictly condemns publishing in predatory journals and warns that publications published in this way do not bring value and are of no importance to the scientific community, medical practice, or the public.

The paper by Fleming, Kotlár, and Pekova was published in a journal of the predatory publisher Herald Scholarly Open Access. [https://www.heraldopenaccess.us/openaccess/quantitative-analysis-of-nucleic-acid-content-in-spikevax-moderna-and-bnt162b2-pfizer-covid-19-vaccine-lots] One Herald journal published a paper about the benefit of garlic in fighting vampires by Hellsing et al., who wrote that the purpose of the paper was "improving the stature of vampire hunting among the scientifically literate populace, and testing whether or not AIMS journals are predatory". [https://www.heraldopenaccess.us/openaccess/allium-argenti-et-aqua-sancta-transgressing-molecular-boundaries-in-hematology-post-alucard]