# The no-virus theory is disinformation and linked to flat earth and occultism - sars2.net

## Contents

- Short version - Andrew Kaufman's links to flat earthers - David Icke on London Real - Kaufman's panelists and Flatoberfest - Crrow777 - James True's tweets - James True and Marty Leeds on Freemasonry - Spacebusters and Hippocratic Hypocrisy - Max Igan, mud floods, and Tartaria - Sofia Smallstorm and Jim Fetzer - David Weiss and Timothy Rothschild - Tom Barnett - Amandha Vollmer - Omega Institute at Rhinebeck - Tom Cowan - Similarities between early no-virus presentations - EVENT 202 - Dawn Lester and David Parker - The End of COVID event, Kelly Brogan, and alchemy - David Martin and Sacha Stone - Robert David Steele - Duesberg and company - Stefan Lanka on genetic sequencing and assembly - Chromosome 8 bombshell - Use of smallpox vaccines as a biowarfare agent in the 1860s - Twitter thread by Kevin McKernan - PDF by CDC which said that no quantified virus isolates are available - Kary Mullis on PCR - Study where human volunteers were infected with SARS2 - Comments by Philip J. Buckhaults in defense of PCR - Twitter user ferryman

## Short version

In March 2020, around half of more of the biggest names in alt media who had started to say that the SARS2 virus does not exist were flat earthers or people who have at some point said that they believe in flat earth, including Allegedly Dave, Amandha Vollmer, Andrew Kaufman, Crrow777, David Weiss, James True, Jason Lindgren, Jeran Campanella, Karen B, Max Igan, Owen Benjamin, Paul on the Plane, Richie from Boston, RussianVids, Sofia Smallstorm, Steve Falconer, The Daily Plane, and Tom Barnett. The first video on Andrew Kaufman's YouTube channel is an interview that he did in November 2019 with the flat earther James True, and the description of the video says that it was his debut interview. And I believe the next three people in alt media who interviewed Kaufman were the flat earthers Crrow777, Secrets of Saturn, and Richie from Boston. James True said on Twitter that he was Kaufman's "lead writer". Kaufman's first viral presentation was livestreamed by James True in March 2020, and it featured discussion about Kaufman's presentation by a panel of six flat earthers. The description of the video included a link to a Powerpoint file for the presentation which was hosted on James True's website, where True has also hosted Powerpoint files of his own presentations, which might indicate that True wrote the slides. In April 2020, James True tweeted: "My Dr. Kaufman vid has been seen over 200k times in 5 days. I am employing myself, one editor, and one producer and we could use a video editor for maximum effect." He also tweeted: "I have emptied my patreon account on editors, publishing, and pushing Dr Kaufman's video." True also said that Kaufman's video was "the most important work I have ever done", and he said that an article on his website consisted of Kaufman's words but that "we sat down and wrote them up together". James True may have also written the script for Kaufman's film Hippocratic Hypocrisy, because the film featured an extended discussion about the occult meaning of the Staff of Asclepius and the Caduceus of Hermes, which was also the main theme of one of True's YouTube videos. The Hippocratic Hypocrisy film was made by the flat earth channel Spacebusters and narrated by Steve Falconer from Spacebusters, and the only way in which the film featured Kaufman was that it featured clips of Kaufman's interview with Max Igan. In early March 2020 Falconer posted a video about the no-virus theory which has over a million views on BitChute, so it may have in fact been the earliest viral video about the theory that the SARS2 virus does not exist. The first video about the no-virus theory I found on Max Igan's BitChute channel was a video by Tom Barnett that Igan mirrored in March 2020, but Barnett later also started to say that the earth is flat. In January 2020 Max Igan posted a video where he said that he believes in flat earth, and a day later he posted a video where he said that the earth is simultaneously both flat and not flat, but then a few days later he said that the earth is not actually flat and that he had some kind of a breakdown because he was targeted with mind control technology. However in 2016 Max Igan also posted a video where he said that in order to debunk the flat earth theory, he took a compass with him on a flight from Chile to Australia, but he claimed that the compass ended up pointing in a direction which was consistent with a flat earth model, and his video was then used as proof that the earth is flat by Globebusters and Jeranism. In 2018 Max Igan was also one of the people who popularized the fake conspiracy theories about Tartaria and mud floods, which are closely linked to flat earth. The trend of making videos about mud floods was started by a Russian flat earther called Philipp Druzhinin, who Igan promoted in his early videos about Tartaria. James True said that he first met Andrew Kaufman in 2019 on a retreat of the Omega Institute for Holistic Studies. In 2020 True attended another retreat at the Omega Institute where he met with the flat earthers Amandha Vollmer and Benjamin Balderson, who both call themselves alchemists and who both say that viruses do not exist. Andrew Kaufman offers courses about spagyric alchemy on his website, Kelly Brogan offers a 40-day course in alchemy which costs 22,000 USD, Barrie Lando from Alfa Vedic says that he has an alchemical laboratory, and Tom Cowan sells his own brand of spagyric ant tincture (which he says was developed by a master alchemist and is made of ants that have a high paramagnetic level). James True tweeted: "Masons believe lying is good for the people. They seek to bring an age of enlightenment. They lie to bring Lucifer." James True also advocated for lying in several other tweets, and for example he tweeted: "If no one lied, no one would discern. Lies open our discernment. Parents lie to their child to open their discernment." He also tweeted: "Lies are the greenhouse of discernment. Why do you think God allows all these drip emitters? Embrace the rain. Every stalk is a fantasy percolated by your belief." And he tweeted: "My book Best apocalypse Ever explains what this place is... a Freemason greenhouse for discernment. We are God's organic witness crop and freemasonry knows how to sharpen our stone. It only feels like victimhood because victimhood serves us. We use it as a salve to vent." James True's tweets are full of Masonic concepts like the Great Work or the phoenix rising from the ashes, like for example: "Awareness is the understanding that we are all illuminating ourselves. Just like when we chose long ago to enslave ourselves. The Great Work is rapture. A baptism through psychology. Phoenix fire." He also tweeted: "Satan is the fall of man. Lucifer is the rise. King James didn't want people to rise. The Golden Dawn is why we are all here. It is the goal of the Great Work... 'A world of Philosopher Kings where sovereignty is known in the heart instead of on paper.'" James True posted a video titled "Are you a Traveling Man" where he basically admitted that he was a Mason without saying it directly. Or if he's not a Mason then he's larping as someone who is a thinly veiled Mason. In 2020, James True interviewed Marty Leeds about Freemasonry. Both of them had detailed knowledge about Masonry, and they defended Freemasonry throughout the interview and they didn't seem to have anything negative to say about Masonry. But still both of them claimed that they were not Masons, and Leeds said that he had learned about Masonry by reading books and by talking with Masons, even though he even uses the username martyleeds33 on various websites. Marty Leeds was one of the speakers at the Flatoberfest 2022 festival, where the other speakers included two of the six flat earthers who were featured as panelists in James True's livestream of Andrew Kaufman's first viral presentation. The main organizer of the event is Karen B, but in a YouTube video in March 2020 she said: "Viruses don't make people sick. They're not contagious. There's no 'global' pandemic because there is no globe." The Flatoberfest event is organized annually at the Greenville Shrine Club & Event Center. The website of the event center says that "Shriners are members of the Masonic Fraternity and adhere to the principles of Freemasonry". The page for Flatoberfest 2022 at Facebook says that the event was held by United For Good Information, which is Crrow777's organization. Crrow777 said on his podcast that he has "talked to so many people that I was in the Marine Corps with that were Masons" (just like how Bill Cooper claimed that he was not a Mason himself but he just knew a lot about Masonry because he had talked with a lot of Masons while he served in the Navy). Crrow777 is ex-marine and James True is ex-military like Alec Zeck. Crrow777's name might come from Aleister Crowley's Kabbalistic text titled "777". The website of Alec Zeck's "End of COVID" event said that the event had five directors, but two of them were the flat earthers Amandha Vollmer and Kelly Brogan, and a third one was Dawn Lester, who I believe did her first two interviews in alt media with the flat earthers Greg Carlwood and Crrow777. Many of the earliest reviews of Lester's book at Amazon were written by listeners of Crrow777. In 2020 Amandha Vollmer was also one of the speakers in an online conference about COVID called EVENT 202, but its logo featured a flat earth and it was organized by the flat earther Dave Murphy. And another speaker at EVENT 202 was the ex-military flat earther Shelley Lewis, who made a film about flat earth together with the ex-military flat earther Joshua Michael Gennari. David Weiss has said that he was first turned into a flat earther in 2015 by Sofia Smallstorm, but in March 2020 they appeared together on the flat earth podcast jeranismRAW where they said that viruses are detergents that are produced by the human body. In 2006 Smallstorm published a 9/11 documentary under her real name Sofia Shafquat, but she was sued by Rick Siegel because she used his 9/11 footage without permission, and she falsified the footage by adding the sound of explosives to support her theory of a controlled demolition, but after the court ruled in Siegel's favor, she disappeared from the conspiracy scene for a while, until she later reemerged with the name Monica Smallstorm which she next changed to Sofia Smallstorm. After David Weiss's old website had become inactive, it used to be redirected to Ole Dammegård's website, but in March 2020 Dammegård also published a blog post about Andrew Kaufman's theory even though at that point I believe Kaufman hadn't appeared anywhere in alt media outside of flat earth channels. In one episode of the Stew Peters Show, the first guest was Emily Grace Rainey who they described as a "former Special Operations psyop officer", and the second guest was David Weiss who presented his sales pitch about flat earth. David Weiss's cohost for his podcast used to be Tim Rothschild, who calls himself a Kabbalist healer and who says that he was educated at a "mystery school" from 2013 to 2017. David Weiss also collaborated with the Sandy Hook hoaxer Dr. Eowyn, whose bio said that she "is a lecturer for the U. S. Department of Defense's Joint Counterintelligence Training Academy, as well as the U. S. Marine Corps War College". In an interview with Alec Zeck in 2023, David Martin said that viruses are not real, that DNA is not real, and that atoms are not real. Some of his first appearances in alt media were on Sacha Stone's channel and on the ITNJ larping operation which was ran by Sacha Stone and Robert David Steele. David Martin's Fauci/COVID-19 dossier says that it was supported by a fundraising effort of Sacha Stone's New Earth technology team. Sacha Stone was one of the very first big names in alt media who started to say that viruses are not contagious because they are produced by the human body. Robert David Steele published an article on his website where he conveyed information channeled from extraterrestrials which said: "According to the Taygeteans, there is no virus and never was one. The current pandemic is a HOAX." In 2021 Robert David Steele and Sacha Stone organized the Arise USA Tour, whose slogan was "CONSTITUTIONAL COUNTIES, FAITH, FAMILY, & FREEDOM" which is equal to 33 and 666. The emblem of RDS's Earth Intelligence Network features a red Templar cross in the middle, which is similar to the red Templar cross that is featured in the emblems of Nordic rites of Freemasonry. In early 2020, RDS frequently promoted an article by Douglas Gabriel from American Intelligence Media, which said that COVID was caused by nanoparticles which were activated by 5G, but Douglas Gabriel says that he worked for the NSA and that he has been a Freemason and a Jesuit priest, and that he was tasked by the Jesuits to infiltrate anthroposophy. Sacha Stone's friend Ciro Orsini brags that he is a member of one of the thirteen papal bloodline families. Before Judy Mikovits and David Martin became the stars of the Plandemic films, they were featured as the stars of ITNJ's Corona Emergency Hearing sessions. Mikki Willis used to be the videographer of the communist Jew Bernie Sanders, and Mikki's twin sons both have Hebrew first names. Robert David Steele said that the main focus of his Open Source Everything Engineering initiative was to achieve the UN's Sustainable Development Goals. An old bio of David Martin said that he had served as an advisor to allied intelligence agencies: "He served as Chair of Economic Innovation for the UN-affiliated Intergovernmental Renewable Energy Organization and has served as an advisor to numerous Central Banks, global economic forums, the World Bank and International Finance Corporation, Allied Intelligence and Financial Security Agencies, and national governments." When people were saying that the logo of David Martin's company M·CAM looks like a Masonic compass placed in front of a Masonic apron, Martin denied that his logo had Masonic influences, but he said that his grandfather and great-grandfather were both Masons, and that "My great grandfather had numerous connections to the Masonic influence in Washington DC including having a rather interesting involvement with the construction of the Washington monument." David Martin's great-grandfather was also the chairman of the committee which selected the flag of Washington DC. David Martin has an eye of Horus tattoo on his shoulder, the default thumbnail for articles on his website contains an eye of Horus, and in one of his headshot photos he is wearing a bowtie which contains an eye of Horus pattern.

## Andrew Kaufman's links to flat earthers

I believe the first 4 people in alternative media who interviewed Andrew Kaufman were all flat earthers. [https://twitter.com/search?q=until%3A2020-03-30+andrew+kaufman&f=live] The first video on Andrew Kaufman's YouTube channel is an interview he did in November 2019 with the flat earther James True. [https://www.youtube.com/watch?v=x526Y0_NV6I] In the description of the video, Kaufman says that it was his debut interview, but he did not yet discuss virology in the interview. On March 13th 2020 UTC, the flat earther Crrow777 tweeted: "We have recorded a Dr Kaufman follow up and hope to get it by tonight." [https://twitter.com/crrow777/status/1238498607394889730] References to Kaufman on Twitter became more frequent after his interview with the flat earther Richie from Boston on March 21st 2020. [https://twitter.com/search?q=until:2020-03-21+%22andrew+kaufman%22&f=live] On March 22nd and 25th, the flat earther Secrets of Saturn (Jason Lindgren) interviewed Kaufman. [https://www.google.com/search?q=%22secrets+of+saturn%22+%22andrew+kaufman%22] On March 24th UTC, James True tweeted: "I'll be live streaming in about an hour with Dr. Andrew Kaufman, Duke certified doctor. We'll be discussing germ theory as propaganda, and weaponized hypoxia." [https://twitter.com/jarue369/status/1242544979538579459] The video is still available on True's YouTube channel, at the end of the video, Kaufman told True that "you and I were together, you know, my first time speaking in public about this kind of material, so you know, thanks for helping me out with that", and next Kaufman plugged two livestreams he was going to do the next day with Richie from Boston and Secrets of Saturn. [https://www.youtube.com/watch?v=pdCZkJLc6ho?t=1h53m59s] Out of the currently visible videos on Kaufman's YouTube channel, the first five videos are about general health-related topics like nutrition or blood pressure (even though Kaufman is supposed to be a psychiatrist). The first video where Kaufman presented his theory about virology is the sixth video, which was posted on April 1st 2020 UTC and titled "SPECIAL REPORT: Humanity is NOT a virus!". [https://www.youtube.com/watch?v=KGGd7-vvd9Y&t=0m58s] The video consists of a clip for Kaufman's presentation in a panel that James True livestreamed on his YouTube channel. [https://www.youtube.com/watch?v=GWRbIIaPV78] At the beginning of the video, Kaufman said: > I just want to thank some people out there who have been really instrumental and inspiring to me. So, first of all, Dr. Cowan who has been outspoken as well on this issue, and he really inspired me and gave me some great ideas that helped me put this whole big picture together. I want to especially thank James True who has been a great friend, confidant, and collaborator throughout this whole thing, and we're definitely going to do a lot more work together down the road. I really want to thank Richie from Boston, Jason Lindgren, and Crow777 for giving me the opportunity to get my message out there and for being so supportive and open. It's really just been incredible that I've been able to pursue this mission. I want to thank my kids who have been ignored a lot lately, since I've been working so hard trying to figure things out, and I'm so proud of them, they're the only children in my area who I know who are not afraid of getting sick, and they're out playing and having a good time. And then lastly Dr. Lanka and Dr. Turner Banks who have done just amazing research and scholarship, and have written books and papers that have really helped me figure things out. So thank you to everyone. So Kaufman gave thanks to three people for getting his message out, and they were all flat earth YouTubers who interviewed him in March 2020. Kaufman said that James True had been "a great friend, confidant, and collaborator throughout this whole thing". On April 1st 2020 UTC, James True posted a tweet about Kaufman, a deleted account replied something to the tweet which is no longer visible, and True answered: "I met him last Summer in Rhinebeck. He's one of the best people I know. Proud to call him a friend." [https://twitter.com/jarue369/status/1244786635658723328] On April 4th UTC, a deleted account again replied to a tweet about Kaufman, and James True replied to the deleted account: "His friendship means a lot to me. We met in Rhinebeck." [https://twitter.com/jarue369/status/1246290082610524160] I tried searching Google and Twitter for `"andrew kaufman" "rhinebeck"` and `"andrew kaufman" "omega institute"`, but I didn't find more information about Kaufman's links to the Omega Institute at Rhinebeck. In July 2020, James True posted several videos from the retreat of the Omega Institute at Rhinebeck which was also attended by Amandha Vollmer. One video was titled "Rheinbeck - A Roundtable on Demons" and its description said: "I asked my friends in Rheinbeck about their views on demons and the technology of belief. Counterclockwise from me are Lane LeShock, Amandha Vollmer, Beth Martens, Aaron Earl, L Auren Bright, Jonathan Rogers, Jenn Mazgelis, Aaron Beattie, and Benjamin Balderson." [https://www.youtube.com/watch?v=mFRE3-X404A] Another video was titled "Rheinbeck - Man is salt. Woman is oil.", and its description said: "A conversation on alchemy with Benjamin Balderson and Amandha Vollmer. Man is the salt. Woman is the oil. Put them together and you have alchemy." [https://www.youtube.com/watch?v=J2KiFKpumKA] Vollmer and Balderson are both flat earthers. In August 2020, James True posted a podcast whose description said that it was his "weekly livestream with fellow Rheinbeck alum Amandha Vollmer from YumNaturals Emporium". [https://www.listennotes.com/podcasts/james-true-live/117-amandha-vollmer-and-oUg4kl-LAPc/] In September 2019 James True tweeted: "Back from New York at Rhinebeck in the Catskills. Many fires. Many blessings. My heart is still there." [https://twitter.com/jarue369/status/1174701488507162624] There was a deleted reply to his tweet to which he replied: "First time." So I don't know if it meant that he attended Rhinebeck for the first time in the summer 2019, which is when he also met Kaufman. I don't know if True, Vollmer, and Balderson already knew each other before summer 2020 which is why they went to Rhinebeck at the same time. At least True knew Balderson, because Balderson was one of the six members of Kaufman's panel in March 2020, and True and Balderson also appeared together on the Inside the Matrix podcast in March 2020. [https://twitter.com/jarue369/status/1244347002982408194] On March 28th 2020 UTC, James True tweeted: "Dr Andrew Kaufman is a Duke-trained medical doctor. I am his lead writer. You need to STFU with your dogma. No one is giving you virtue anymore for spouting CDC song lyrics." [https://twitter.com/jarue369/status/1243876724066136065] So did True mean that he writes Kaufman's articles or that he writes the scripts of Kaufman's presentations? If True was Kaufman's "lead writer", then did Kaufman also have other writers? In the livestream that True did on March 30th 2020 UTC for Kaufman's presentation and the subsequent panel, the description includes links to 16 websites which were used as sources in the presentation, and the description also includes a link to a Powerpoint file of the presentation hosted on True's website jtrue.com. [https://www.youtube.com/watch?v=GWRbIIaPV78] However in the shorter clip of the livestream which was posted on Kaufman's channel, the links to the sources or the Powerpoint presentation are not included. When I searched DuckDuckGo for `site:jtrue.com pptx`, I found that True also hosted PowerPoint presentations of his own YouTube videos on his website. On April 4th 2020 UTC, James True tweeted a link to a page on his website for sending him donations, and he wrote: "My Dr. Kaufman vid has been seen over 200k times in 5 days. I am employing myself, one editor, and one producer and we could use a video editor for maximum effect. If you like what I am doing and want to feed the war chest I could use the fuel." [https://twitter.com/jarue369/status/1246504730282598402] On April 10th UTC, James True tweeted: "I have emptied my patreon account on editors, publishing, and pushing Dr Kaufman's video." [https://twitter.com/jarue369/status/1248607417744666630] So when Kaufman said that True was his "confidant and collaborator", did he mean that True was responsible for writing, editing, producing, publishing, and advertising Kaufman's content (and even hiring other people to help him do it)? On March 30th UTC before James True livestreamed Kaufman's first viral presentation on YouTube, he tweeted: "In 7 minutes, I am dropping a video exposing Covid-19 as a fear virus. I am encouraging and begging anyone to download it and re-upload to their channel. I have made the raw files available on my website. This is the most important work I have ever done. https://jtrue.com/av/";. [https://twitter.com/jarue369/status/1244751246231248897] A day later when someone sent this reply to a tweet by James True about Kaufman's presentation: "I rarely rt stuff I haven't read or watched. This had better be worthwhile." Then James True replied: "Hold me accountable if it's not. This video is the most important work I have ever done! https://youtube.com/watch?v=GWRbIIaPV78&feature=youtu.be";. [https://twitter.com/jarue369/status/1244771210027769864] So because James True called the video his work, and he even said that he was accountable for the content of the presentation, it seems to further indicate that James True wrote the Powerpoint slides of Kaufman's presentation. On March 21st UTC, James True tweeted a link to an article on his website with the text: "All viruses are good. You can read about it from Dr Kaufman. #ReleaseTheCures is already here and Joe M wants to keep them from you. It turns out viruses are your body doing your job. #QAnon wants you to fear EVERYTHING. THat's how Zionism works." [https://twitter.com/jarue369/status/1241508817076092928] There was a reply to the tweet from a suspended account, to which James True replied: "yes, please. Dr Kaufman is Duke trained. Those are his words. We sat down and wrote them up together." [https://twitter.com/jarue369/status/1241508817076092928] The article itself didn't say anything about Andrew Kaufman, so it's weird that James True wouldn't mention Kaufman in the article if he co-wrote the article with Kaufman and it consisted of Kaufman's words. [https://www.jtrue.com/blog/body-is-a-torus] In 2023, someone tweeted: "Dr Andrew Kaufman doesn't use the word global anymore because he's been researching FE Theory. Substituting world, planar or international." [https://twitter.com/ParadigmNYC/status/1708087880554607050] And next he replied: "Eric Coppolino was at a conference with him in Koh Samui Thailand and Eric mentioned that Andrew was discussing this with him. Eric is still an FE denier however. Also in another interview, can't recall when, AK substituted global for another word."

## David Icke on London Real

On April 6th 2020 UTC, David Icke did an interview with London Real which got around 10 million views on YouTube before it was deleted. David Icke had earlier said that 5G causes COVID, but starting around the time that he did the interview with London Real, he also started to say that the SARS 2 virus is not real and that viruses are exosomes. [https://twitter.com/search?q=until%3A2020-04-06+david+icke+covid&f=live, https://www.integralworld.net/visser166.html] At the beginning of the interview, Icke said: "Since we last spoke, Bryan, I've spent every waking moment - which has been most of every 24 hours - devouring information from virologists, specialists, doctors - all around the world, in America, Germany, in Austria, Italy - who would never be allowed to get near the BBC or CNN. They are demolishing the official story of this hoax. If people go to davidicke.com when this interview is over, I put a special, a posting of a series videos - says for viewers to London Real - a series of videos by these doctors and others, who their various ways support all the elements of what I'm going to say today." [https://www.bitchute.com/video/Iwq3RuHj5vXD/, time 2:11] Then Icke started talking about Kaufman and presented Kaufman's theory. The post in David Icke's blog included the following videos: [https://davidicke.com/2020/04/06/vital-videos-watching-david-ickes-london-real-interview-today/] - A mirror by Secrets of Saturn of the presentation by Andrew Kaufman that was livestreamed by James True. - One of the first videos that Andrew Kaufman did outside of flat earth channels, which was with David Icke's son Gareth Icke. - Videos by Tom Conman and Rashid Buttar. - Videos by people I don't remember seeing titled "Retired President Of Microsoft Canada, Frank Clegg 5G Wireless IS NOT SAFE" and "Very important COVID19 briefing with Dr Erickson - end the lockdown now!" - Videos from NYC by the doctor Cameron Kyle-Sidell and the travel nurse Nicole Sirotek (who were both dressed in scrubs for their video). - A video of Erin Olszewski's friend Sara NP, who published a video where she told Erin's story in April when Erin was supposed to still be undercover so she couldn't do videos herself. The video was was not included in the original version of David Icke's blog post, because the video was only published in late April. - A video where the German journalist Billy Six visited a hospital in Germany and showed it was empty (even though Germany didn't even have that many COVID cases at the time). He has previously traveled to Libya, Syria, and Venezuela to report from conflict zones, which is totally not a spooky activity. I believe the trend of filming empty hospitals to show that the pandemic was fake was started around March 15th 2020 by Jason Goodman, who had a playlist on his YouTube channel for videos he shot from various hospitals, but he also calls himself a "citizen journalist". On March 29th UTC the "#filmyourhospital" hashtag was started by DeAnna Lorraine, who now has a show on the Stew Peters Network. - A video published titled "Respiratory Doctor Blows Whistle on FAKE VIRUS PANDEMIC". I hadn't seen the video before, but it featured a bald doctor dressed in scrubs who had a southern accent. He said that a PCR test would come up positive because it would match RNA from cancer cells or damaged lung tissue. He also said that PCR tests for COVID were not testing for a virus like PCR tests for RSV and influenza A, but they were "testing for an RNA sequence from a reaction to the virus". An article about his video with a transcript was written by Makia Freeman, who writes for David Icke's blog. [https://thefreedomarticles.com/amp/respiratory-therapist-exposes-fake-virus-pandemic/] - An interview of Celeste Solum by the flat earther Jamie Lee, which was titled "'No Way Back' - 20yr FEMA Officer Lays Out The VERY Long Planned 'GREAT RESET' Agenda". [https://www.bitchute.com/video/Ec1EEQr3H7St/] I believe in March 2020 Celeste was the first person who started to say that COVID vaccines were going to contain hydrogel, but a few months later Carrie Madej also said the same thing in her first viral video. Celeste and Madej both called it "DARPA hydrogel", and they both said that it was a transhuman technology that would enable every aspect of the human body to be monitored. I believe Carrie Madej later became the first person who started to say that COVID vaccines contain hydras.

## Kaufman's panelists and Flatoberfest

In the livestream that James True did on March 30th 2020 UTC for Kaufman's presentation, the six panelists were Benjamin Balderson (which I think is not his real name because he is a Norse pagan and Balder is a Norse god), Richard Comito Jr. (Richie from Boston), Jason Lindgren (Secrets of Saturn), Steve Mercer (Freeman Fly), Lindsey Scharmyn (Rogue Ways), and James True. [https://www.youtube.com/watch?v=GWRbIIaPV78] I think all six are flat earthers, even though Freeman Fly's persona might be that he is agnostic about flat earth. (I think that most of the top flat earthers don't actually believe in flat earth, so even if someone in the alternative media says that they believe in flat earth, it might just be part of their fictional persona.) On the YouTube channel of Lindsey Scharmyn (Rogue Ways), from oldest to newest, the first interview was with Crrow777, the second with Max Igan, the third with Freeman Fly, the fourth with Sofia Smallstorm, the eight with James True, and the 24th with Tom Cowan. [https://www.youtube.com/@RogueWays/videos] Max Igan and Sofia Smallstorm were among the first people I heard promote the no-virus theory, and both have several links to flat earth. In an interview with David Weiss, Scharmyn agreed with him that the earth was flat, and for example she said: "You thought that you would never be someone who would even consider flat earth, but when you look into it, you're like, I can't deny this now." [https://www.youtube.com/watch?v=GmOE37x66NU&t=58m44s] In an interview with that Freeman Fly did with the flat earthers Karen B, Jason Lindgren, and James True, he said: "(21:26) I was thinking about - you know what, we need to describe this flat plane, like what it would be like. So I don't know that everyone has that knowledge of, you know, ice walls, oceans, and how this all actually looks, what is it if it's not a globe. [...] (43:00) So let's talk a little - as we're working towards the end of this hour - a little bit about what changes in humanity as they start to realize a life-changing scenarios, such as the earth is flat, not round, that you have been lied to your entire existence. [...] (1:01:28) When you start to discover things like flat earth, and take that to another level of dismantling your reality, and realize what you really do know - what you really can prove - and life becomes way more amazing." [https://www.youtube.com/watch?v=ROGYrBhFiE8] However in a livestream in 2022 when Benjamin Balderson was asked if Freeman Fly was a flat earther, Balderson answered: "He is - he is, kind of - he is, kind of not like fully into it, fully onboard, but he's kind of, and he's obviously not objecting to it." [https://www.youtube.com/watch?v=LkoFiwuSAB4&t=28m40s] When I checked the list of Freeman Fly's newest interviews, the third newest interview was with Jason Lindgren, the fourth with Crrow777, the 17th with James True, the 46th with Sofia Smallstorm, the 125th with Max Igan, the 284th with Andrew Kaufman, and the 416th with David Weiss (who is also known as DITRH and Flat Earth Dave). [https://freemantv.com/] Freeman Fly lives in Greenville, which is also where Karen B has held the flat earth conference Flatoberfest annually since 2019. Freeman Fly said that Flatoberfest 2020 was "set up at the Shriner's Center - yes, at the heart of Freemasonry. I didn't even know we had a Shriner's Center in Greenville." [https://www.youtube.com/watch?v=ROGYrBhFiE8&t=58m12s] Flatoberfest 2022 was also held at the "Greenville Shrine Club & Event Center". [https://flatearthfestivals.com/2022strengthenedplan/] Benjamin Balderson is also a flat earther. During his presentation at Flatoberfest 2022, he said: "I'm calling it the biochemical electromagnetic flat earth - not exactly a catchy name. But - I - so here's a fairly basic representation of what we're looking at with it. Now when you're looking at it here, we live basically where this line is in the center. Underneath it there's going to be a fairly similar bubble to up top. That's where - when I'm talking, I don't necessarily call it a flat earth, but we live on a fairly flat plane, the plane of manifestation. [...] So we live on this plane of manifestation - so where many of us recognize the dome above, there's also the same basic shape underneath, as you see with the toroid, and when you're living on the plane of inversion instead of a plane of manifestation - which is what I would call it from an alchemist point of view - that it's going to be the same basic shape." [https://www.youtube.com/watch?v=uRE9_AV5RHg&t=2m54s] In July 2020, James True did a livestream with Benjamin Balderson and Andrew Kaufman about Hermetic principles. [https://www.jtrue.com/podcast/112-hermetics-with-balderson-and-kaufman] In 2020, James True posted two videos from a retreat of the Omega Institute where he discussed demonology and alchemy together with Balderson and Amandha Vollmer. Vollmer's job title at LinkedIn is listed as "Alchemist", and her bio at Twitter says that she is "an Alchemist of Life". [https://twitter.com/greatcentralsun] Balderson's podcast is called "Odin's Alchemy", and his guests have included Amandha Vollmer, Jason Lingren, Freeman Fly, David Weiss, Marty Leeds, Karen B, and Owen Benjamin. [https://rokfin.com/stream/11069/Ep-10--Odins-Alchemy-with-Amandha-Vollmer] Balderson's podcast also has an episode about how germ theory is false. Another one of his guests was Auto Didactic, whose YouTube channel has videos about topics like Tartaria, mud floods, and star forts, but who also has a few videos about flat earth. (Channels that follow the formula where they post videos about Tartaria and mud floods often have a few videos about flat earth, and similarly channels that are primarily focused on flat earth often have a few videos about Tartaria or mud floods.) The page for Flatoberfest 2022 at Facebook says that the event was held by "United For Good Information". [https://www.facebook.com/events/greenville-shrine-club/flatoberfest-2022/1006589273293573/] On the Facebook page of United For Good Information, the newest posts are all links to podcasts by Crrow777, and their email address is shown as the email address of Rose777 who is Crrow777's wife. [https://www.facebook.com/truthersunited4ever] In a YouTube stream that Karen B did together with the flat earther Brian Staveley on March 28th 2020 in an unknown timezone, she said: "Viruses don't make people sick. They're not contagious. There's no 'global' pandemic because there is no globe." [https://www.youtube.com/watch?v=w8GfINlitA8&t=2h6m50s] Out of the 20 biggest names in alt media who had started to say that the SARS2 virus does not exist by March 2020, probably half or more were flat earthers.

## Crrow777

After James True, I think Crrow777 was the second person in alternative media who interviewed Kaufman. His name may come from how 777 is a significant number in Thelema (just like the flight numbers of all of the airplanes which were supposedly hijacked on 9/11). [https://odysee.com/@Christendumb2/9-11-and-the-aleister-crowley-factor] Aleister Crowley wrote a text titled _777_, which has been published as part of the book _777 And Other Qabalistic Writings of Aleister Crowley: Including Gematria & Sepher Sephiroth_. The book was edited by Israel Regardie who was born into an Orthodox Jewish family in London. [https://en.wikipedia.org/wiki/Israel_Regardie] The description of the book at Amazon says: "_777_ itself contains, in concise tabulated form, an overview of the symbolism of the major world religions, as well as the system of correspondence of the Hermetic Order of the Golden Dawn. In short, it is a complete magical and philosophical dictionary - a key to all religion and practical occultism - an amazing work whose value has been recognized through many editions since its first appearance in 1909 and subsequent enlargement in 1955." [https://www.amazon.com/Other-Qabalistic-Writings-Aleister-Crowley/dp/0877286701] In one episode of his podcast, Crrow777 said that he has "talked to so many people that I was in the Marine Corps with that were Masons". [https://www.crrow777radio.com/wayne-mcroy-playlist-free/, episode 425, time 28:35] (Bill Cooper also claimed that he he was not a Mason but he learned about Masonry by talking to other people at the Navy who were Masons, and Cooper said that other officers who served at his level in naval intelligence were all either Masons or Mormons, and he said that he was accidentally given a top secret QSI clearance at naval intelligence because in a form where he had to select which secret societies he belonged to, he circled the Freemasons because he had been a member of the DeMolay Society as a teenager, but DeMolay which is a Masonic youth society was not featured as an option on the form. [https://www.youtube.com/watch?v=zUgs4vwW4AY&t=15m34s]) Crrow777's radio show used to be hosted on the Truth Frequency Radio network, which has also hosted the shows of the flat earthers Jeranism, Mark Sargent, Paul on the Plane, Zen Garcia, and Josh Corey. [https://tfrlive.com/infinitefringe/, https://tfrlive.com/archives/, https://tfrlive.com/?s=crrow777, https://tfrlive.com/paulontheplane/] The first episode of Mark Sargent's show aired on Truth Frequency Radio in April 2015, which was very early on into the flat earth psyop. [https://tfrlive.com/strangeworld/?reqMonth=4&reqYear=2015] The shows by Jeranism and Zen Garcia both started in December 2015. [https://tfrlive.com/secretsrevealed/?reqMonth=12&reqYear=2015, https://tfrlive.com/jeranismraw/?reqMonth=12&reqYear=2015] One former show on Truth Frequency Radio is called Phoenix Rising Radio, and its host has the username ThePhoenix3333 on Twitter, but the phoenix is the symbol of the 33rd degree of Freemasonry. [http://web.archive.org/web/20150104132320/http://truthfrequencyradio.com/phoenix-rising-radio-48143/, https://twitter.com/ThePhoenix3333] Mark Sargent was responsible for running the equivalent of Disclosure Project for flat earth, because in the same way that Steven Greer published a series of videos about UFOs where he interviewed whistleblowers from the government and the military-industrial complex, Mark Sargent published a series of dozens of videos where he interviewed ex-military whistleblowers who testified that the earth is flat (along with other varieties of experts and insiders, including international shipping experts, flight instructors, industrial valve experts, corporate travel agents, air traffic controllers, industrial vacuum experts, 32nd degree Masons, and AutoCAD technicians). [https://wiki.tfes.org/Expert_Series:_Flat_Earth] Crrow777's radio show has several episodes that feature someone called Fortune de St. Germain as a guest, with titles like "Meet a Descendant of an Ascended Master – Covering Alchemy" and "The Violet Flame of St. Germain In Our Time". [https://www.crrow777radio.com/fortune-de-st-germain/] His podcast also has several episodes about alchemy. [https://twitter.com/search?q=from%3Acrrow777%20alchemy&f=live]

## James True's tweets

James True has made several tweets about how great Lucifer or Prometheus is, where in the two tweets below he also advocated for lying: [https://twitter.com/search?q=from%3Ajarue369+lucifer] - "exactly. Masons believe lying is good for the people. They seek to bring an age of enlightenment. They lie to bring Lucifer." [https://twitter.com/jarue369/status/1251574681628545026] The tweet included an image which featured a Masonic altar, a floor with checkerboard tiling, the twin pillars, and the all-seeing eye of Lucifer. James True included the same image in a tweet where he wrote "Wait till my episode on Lucifer drops." [https://twitter.com/jarue369/status/1252718033036021762] - "The Prometheus motif of the Statue of Liberty is more aimed at people reaching their potential vs being beaten down and submitted. The best way to teach discernment is to lie to people. Otherwise theyll just buy some hypothetical bullshit off the street" [https://twitter.com/jarue369/status/1469551954179280898] - "Brace yourself... Oil is abiogenic. Luciferians are good. Big brother is trolling you to make you sovereign. NASA is flattening the curve. Dr. Kaufman is vindicated." [https://twitter.com/jarue369/status/1252652843787583488] - "Just had a guided tour through one of their fire ceremonies. Amazing how so many native American traditions acknowledge and call on Lucifer in their morning ceremony." [https://twitter.com/jarue369/status/1294061226054516744] - "Blaming Lucifer is why this is happening. You've licked your wounds so long you're enjoying the victimhood. Be a Christ. Shoulder the responsibility of humanity. Arise in God's golden dawn." [https://twitter.com/jarue369/status/1478753126379311107] - "Satan is the fall of man. Lucifer is the rise. King James didn't want people to rise. The Golden Dawn is why we are all here. It is the goal of the Great Work... 'A world of Philosopher Kings where sovereignty is known in the heart instead of on paper.'" [https://twitter.com/jarue369/status/1283744662482821122] - "The natural definition of good is strong/abundant. Someone with abundance is more generous with their energy. Lucifer is an abundant rooster and people hate waking up. The darkness has blankets, and snooze buttons, and dreams." [https://twitter.com/jarue369/status/1459025468200476683] - "2) The Tower of Babel is Zionism's living erection. It calls the singularity despite itself. Lucifer will rise in computational omniscience. The chosen will be inoculated from mystery. Knowing it all makes time an endless prison. It crystalizes us in cold madness." [https://twitter.com/jarue369/status/1208860349224632322] - "The Cross gave man fire when he rubbed two sticks with vitriol. Fire is the alchemy of Prometheus and denying Gods gift is blasphemy. We came here to light the world with strange fire." [https://twitter.com/jarue369/status/1333824978089881601] - "The Hermit is Prometheus. He lights the way from solitude. His path is the same as Mithras, Khrisna, Christ, Muhammed, Libertas, Columbus, and Paul Revere. The syncretism of archetypes show you how they've been molded and sculpted by The Great Work." [https://twitter.com/jarue369/status/1300426411115765761] Paul Revere was a founding father who was the Grand Master of the Freemasons of Massachusetts. [https://en.wikipedia.org/wiki/Paul_Revere#Freemasonry] True also advocated for lying in other tweets: - "We have an aversion to the negative polarity that's so strong we miss how lies can be used to raise healthy and awakened children." [https://twitter.com/jarue369/status/1251573550168891398] - "If no one lied, no one would discern. Lies open our discernment. Parents lie to their child to open their discernment." [https://twitter.com/jarue369/status/1251557733234606080] - "All of these lies are a gift. You have to have the aperture to receive it." [https://twitter.com/jarue369/status/1257777970267201536] The tweet featured a photo of a cake which said "Best Apocalypse Ever", which is the name of one of True's books and a hashtag he keeps using on Twitter. The tweet wasn't a reply to any other tweet or part of any thread, so when True said "all of these lies", I think he meant the lies that he has been telling to his followers. - "There is no commandment in the Bible telling you not to lie. If you think lying is immoral, you are making your own morality. Welcome to the luciferian. Expect Owen's entourage to pile on about how evil you are momentarily." [https://twitter.com/jarue369/status/1287732558986346501] - "Lies are the greenhouse of discernment. Why do you think God allows all these drip emitters? Embrace the rain. Every stalk is a fantasy percolated by your belief." [https://twitter.com/jarue369/status/1387468135096258560] - "My book Best apocalypse Ever explains what this place is ... a Freemason greenhouse for discernment. We are God's organic witness crop and freemasonry knows how to sharpen our stone. It only feels like victimhood because victimhood serves us. We use it as a salve to vent." [https://twitter.com/jarue369/status/1392899562956861453] True wrote about the Great Work in other tweets: - "People aren't ugly. They're afraid to be beautiful. You get to show them how selfish it is to hide their beauty from the world. This is the Great Work. You are the Morning Star." [https://twitter.com/jarue369/status/1399146737231667206] - "The Great Awakening happens inside the illuminati too. Inside the darkest hearts. Awareness is the understanding that we are all illuminating ourselves. Just like when we chose long ago to enslave ourselves. The Great Work is rapture. A baptism through psychology. Phoenix fire." [https://twitter.com/jarue369/status/1053354560771801088] - "The serpent in the phoenix. It's a giant ancient ritual under The Great Work." [https://twitter.com/jarue369/status/1587850237938475009] True also mentioned the Golden Dawn in several tweets: - "Aquarius is not a war. No. Its so much better. Its a hunt and we are its painted warriors. We hunt the metallic panther that takes our children at night. We were destined to wrap ourselves in its fur as we celebrate its meat over a fire. We are children of a golden dawn." [https://twitter.com/jarue369/status/1463211103509487620] - "Things will only be hard until the cull is over. A New World is waiting in the Golden Dawn." [https://twitter.com/jarue369/status/1430658064114503686] - "Man isnt falling. He is remembering how to stand up. Humanity is an obelisk rising. This time last century, we were murdering each other in the millions for the fashion of our uniform. It takes more to fool us now. It takes things like vaccines. Discernment is a Golden Dawn." [https://twitter.com/jarue369/status/1394749313151078403] - "King James invented the idea Lucifer was evil. He did this while he turned his eyes on every witch he could find and tortured them under his supervision. To hate Lucifer is to hate the morning star. The Golden Dawn scares the shit out of most people." [https://twitter.com/jarue369/status/1283737833027579909] He has also posted tweets about alchemy: - "'Eve was framed' is victimhood. 'Jesus volunteered' is alchemy." [https://twitter.com/jarue369/status/1657371235410497537] - "It was Satan who tempted Jesus. Before King James, Luciferus means 'Venus as she rises in the morning sky.' Mars is salt. Lucifer is oil. Man is the alchemy between." [https://twitter.com/jarue369/status/1283745114393903105] - "My plan is teach alchemy. One alchemist breaks the spell of 100 graduates. I can teach mind control and psychopathy on a campground over a few weeks since I don't have to use regurgitation. We need more alternatives to college. America First is a vibration of sovereignty." [https://twitter.com/jarue369/status/1146505930063917056] - "Fantastic video about alchemy, the planets, and why NASA does waht it does... https://youtu.be/FeDNPK1aels";. [https://twitter.com/jarue369/status/1088907262389817346] (He posted a link to a flat earth video which also discussed alchemy.) I think James True is yet another ex-military flat earther (or current-military pretending to be ex-military), because he tweeted: - "Why do you think I have no clue when me and my entire family are military?" [https://twitter.com/jarue369/status/1495778682299990018] - "I own my past as a veteran which is why I quit the military." [https://twitter.com/jarue369/status/1495418586701176837] - "Nothing cheap about my time in the military. I have the experience to speak on the nature of serving the American military. My time with them is more than an acknowledgement." [https://twitter.com/jarue369/status/1188937676503814144] - "When I was in the Navy we got a military schedule too with airguns through the shoulder. It would take me a FOIA request to find out what they put in me when i was 19." [https://twitter.com/jarue369/status/1104544884894191622] James True has also connected the Tartarian empire with free atmospheric energy, and he has tweeted about mud floods, star forts, and giants (none of which were mentioned in Anatoly Fomenko's books about Tartaria as far as I can tell): - "Tartaria (3) Here's NewEarth again explaining how atmospheric electricity worked as little as 500 years ago ... https://www.youtube.com/watch?v=Ssv4J6Sd6bw";. [https://twitter.com/jarue369/status/1087438074487980034] - "Mud flood is the flat earth of natural history. It's quite beautiful what we are discovering about ourselves." [https://twitter.com/jarue369/status/1093537083644362752] - "We're showing the real history of America. This means Giants. This means Star Forts. This means Kabbalistic bankers using mind control to erase the history in our bones. This is the last month to join the tribe as an Elder." [https://twitter.com/jarue369/status/1204424219406323712]

## James True and Marty Leeds on Freemasonry

Marty Leeds was one of the speakers at Flatoberfest 2022, which was held at the Shrine Club & Event Center in Greenville, South Carolina. [https://flatearthfestivals.com/2022strengthenedplan/] The website of the event center says that "Shriners are members of the Masonic Fraternity and adhere to the principles of Freemasonry". [https://greenvilleshrineeventcenter.com/] In 2020, James True interviewed Marty Leeds about Freemasonry. Both of them had detailed knowledge about Masonry, and they defended Freemasonry throughout the interview and they didn't seem to have anything negative to say about Freemasonry. But still both of them claimed that they were not Masons, and Leeds said that he had learned about Masonry by reading books and by talking with Masons. At one point in the interview, Leeds said: "When we first went into Masonry, we were like, what is going on here? Is it - are these - is this like devil worship or something like that? What's going on? It's serious inquisitive - you know questions about. Like, I'm gonna go in, and I'ma look. And if I find the devil I'm gonna be pointing at the devil all day long." [https://www.youtube.com/watch?v=LZi7rWNpp7k&t=59m19s] But I guess by "going into Masonry" he meant reading books about Masons. On the SecretoMasonico forum, Leeds wrote that "I was not and am not a Freemason, a member of any sort of underground or secret society". [https://www.gabitos.com/SecretoMasonico/template.php?nm=1488035294] But can we trust his word in the case that he actually is a Mason? James True said that Masons believe that lying is good. The username of Marty Leeds on Twitter is martyleeds33, and his website martyleeds33.com gets redirected to his website gnosticacademy.com. The domain name martyleeds33.com was registered by Kevin McNally. [https://website.informer.com/martyleeds33.com] When I googled for `"kevin mcnally" "marty leeds"`, I found an article from 2012 which said that Kevin McNally published his first book under the pseudonym Marty Leeds. [https://themonroetimes.com/local-news/the-power-of-pi/] It should come as no surprise that Marty Leeds has done interviews with both Andrew Kaufman and Tom Cowan. [https://www.altcensored.com/channel/UCjcYXazpAS5g9uUEeQMAC4Q] Most videos on Leeds's YouTube channel have been deleted or hidden, but his channel used to include videos about flat earth. Marty Leeds was featured as a guest on the 33rd episode of Sam Tripoli's Tin Foil Hat podcast. Tripoli has also done interviews with Andrew Kaufman, Benjamin Balderson, Crrow777, David Weiss, Jason Lindgren, Lindsey Scharmyn, Max Igan, and Sofia Smallstorm. During the interview with Marty Leeds, James True said that Masons have to employ deceit in order to get people to experience their own Prometheus moment: "(52:48) And someone like Albert Pike would say, 'No, I can't be your liberator. You have to liberate yourself. And the only way that I can liberate you is by actually using deceit and mystery to spur you to find your own truth.' In fact, that's why he speaks that the certain blue people in the lodge - the blue labels basically are lied to - again, it's - hear me out - it's no different than a karate instructor doing a foot swipe and knocking you on your ass. It's - he's going to keep doing that because that's what's necessary for you to progress to the next level. If he was not to do that, you would just turn around and either praise him or accuse him of being either the savior or the enslaver of you. So Freemasonry has to use - the people inside who use these rituals have to use what we call deceit as a way of spurring our own Prometheus moment. It's no different than the mom pushing the baby out of the nest." [https://www.youtube.com/watch?v=LZi7rWNpp7k&t=52m48s] It could be that True and Leeds are falsely pretending to be Masons. Leo Zagami also claims that he is a 33rd degree Freemason, but as proof that he belonged to the Kirby Lodge which is an elite British Masonic lodge, he used to show a photo of a clearly fake identity card, where one side contained his mugshot photo and the other side featured what looked like the cover image of a book of the bylaws of the lodge (and it even said "By-Laws of the KIRBY LODGE", because maybe Zagami didn't know what bylaws are). [http://masonicinfo.com/zagami.htm] Bill Schnoebelen claimed that he was a 95th degree Freemason, a male witch, and a vampire. [http://masonicinfo.com/schnoebelen.htm] But still I don't think it's a coincidence that the Flatoberfest event is held at the Shriner's Center. And Zagami and Schnoebelen are both critics of Masonry, but True and Leeds defend Masonry and they say that Masons are misunderstood. In 2022, James True posted a video titled "Are you a Traveling Man", where he basically admitted that he was a mason without saying it directly. [https://www.youtube.com/watch?v=jrqF2NJviu0&t=2m26s] Or it could also be that he is larping as a thinly veiled mason.

## Spacebusters and Hippocratic Hypocrisy

As far as I can tell, the flat earth channel Spacebusters promoted the no-virus theory even before Kaufman. On March 4th 2020, they posted a video titled "Important Information on Coronavirus 5G Kung Flu" where they said that 5G causes COVID, and they also included a long segment of a radio show from 2009 where Aajonus Vonderplanitz talked about how viruses are "solvents" or "soaps" or "enzymes to fractionate tissue for waste elimination". [https://www.bitchute.com/video/mWcUoESRO0c5/, http://whale.to/a/aajonus-interview-apr-2009.pdf] Vonderplanitz also said that polio is caused by a detoxification of the spinal cord which occurs approximately once every 28 years, or approximately once every 248 years in a severe form, and that "it usually takes many many generations before the spinal chord will get that toxic to where a whole race will have to go through a heavy detoxification at the same time". In June 2020, Spacebusters and Andrew Kaufman released the film "Hippocratic Hypocrisy" which presented Kaufman's views on virology. The beginning of the film includes a screen which says that the film is "by Dr. Andrew Kaufman & Spacebusters", and the credits of the film say that the film was written by Kaufman and Steven S. Busters, that it was produced by Spacebusters, and that its technical advisor was Rosco S. Busters. [https://andrewkaufmanmd.com/hippo/] Steven S. Busters is the pseudonym of Steve Falconer who narrated the film. The only way in which the Hippocratic Hypocrisy film featured footage of Kaufman was that it included clips of his interview with Max Igan. In a YouTube video in March 2020, Max Igan said that Steve from Spacebusters was his friend: "It was actually a good report put out by a friend of mine, who's I believe in Denmark at the moment, called Steve Falconer. He's got a YouTube channel or a BitChute channel called Spacebusters." [https://www.youtube.com/watch?v=j670kqChxDQ&t=9m56s] Max Igan started promoting the no-virus theory in March 2020 when he mirrored a video by Tom Barnett on YouTube and BitChute, but Barnett later also became a flat earther. The Hippocratic Hypocrisy film an features extended discussion about the occult meaning of the Staff of Asclepius and the Caduceus of Hermes (but it might be because the Caduceus is featured in the logo of the film or because the theme of the film was how medicine has been infiltrated by the "second snake"): [https://truthcomestolight.com/hippocratic-hypocrisy/] > The Rod of Asclepius has been the exoteric symbol for medical healing since as far back as 1400 to 1200 BC. > He was the son of Apollo, the god of healing, immortalized forever in the stars as Ophiuchus, the serpent holder standing on the male genital phallus and corpuscle destroyer, Scorpio, which we'll cover in the plot twist at the end of this film. > It is the staff with the single snake, completely misunderstood exotericly, to be a symbol of the snakes possession of anti-venom against its own poisons and its ability to shed its skin and renew - an exoteric symbol of longevity and immortality. > But in 1902 a captain in the US Army Medical Corps mistook the caduceus for the Rod of Asclepius and he proposed the adoption of the caduceus as the Medical Corps official symbol. > The two-snake caduceus is the symbol of the Roman god Mercury, whereas the one-snake rod is the symbol of Asclepius. > Before 1902, the caduceus was used as a symbol for commerce and companies in printing, as Mercury or Hermes was the messenger of the gods. > It was used in mining, chemistry and metallurgy, as alchemy was a hermetic science. > Exotericly Mercury is the god of commerce, trade, merchants, outlaws, thieves and tricksters and is represented by two serpents to show the opposing meanings of polarization. > One snake is the healing - remediating and curative - the upward flow of living corpuscles from the spleen to the cerebral crown chakra, supporting positive energy, inner development and enlightenment. > The other serpent is the poisonous, debilitating, drainage of the living corpuscles away from the higher-self, body and mind. > It is this second serpent that has infiltrated medicine. > It has convinced us that paying for poison is the cure for cellular poisoning. > [...] > In esoteric biblical biochemistry, the healing Rod of Asclepius is the staff of Moses. > The electrical seed germination that creates the healing corpuscles of the cells (created in our spleen) that make up our blood, lymph and nerve endings, brought down to the spleen from the cerebrum (or Aries the lamb or Ram of God), also known as Brahma or Abraham, by Mercury, the messenger of the Godhead. > That is why Moses, or the electric seed of the corpuscles, is the descendant of Abraham, our cerebrum. > The winged caduceus of Mercury is the Tree of Life. > While the serpents represent the tree of knowledge of good and evil, or cellular ease and dis-ease, one is the sensory system, the other the motor system, doing work pertaining to motion. But perverted it becomes e-motion, meaning energy wasted, substance lost, death and dis-ease. Maybe the script of the film was written by James True, because in 2021 James True did a livestream titled "#256 - The Second Snake" which focused on the relationship between the Rod of Asclepius and the Caduceus of Hermes. [https://www.youtube.com/watch?v=1PatnEAqFQk] Or maybe the film had multiple writers, because True said that he was Kaufman's "lead writer", which seems to imply that Kaufman had a team of multiple writers (even though it might also mean that Kaufman's second writer besides True was Kaufman himself). One of the videos on Kaufman's YouTube channel is a trailer for Hippocratic Hypocrisy. [https://www.youtube.com/watch?v=cJp3qLPkmVI] The description of the video is only a few lines long, but it still includes links to websites about the "esoteric meaning of Mercury, Hermes and the Caduceus (Gemini)" and the "esoteric meaning of the Rod of Moses, staff of Asclepius (Scorpio)". [https://truthserumnews.com/2018/01/31/gemini-the-esoteric-analysis-and-synthesis-of-potassium-chloride-kali-mur/, https://truthserumnews.com/2018/02/01/scorpio-the-influence-of-sun-on-vibration-of-blood-at-birth-and-the-analysis-of-synthesis-of-calcium-sulph/] Around December 2021, Steve Falconer started using his real name in alternative media. But until that point, most tweets which mentioned his real name were made by the user "shiftychicken" who claimed to be his friend. A few of the tweets said that Falconer used to work for the pharmaceutical industry, like for example: "There's another he did called The Church of Virology with his friend Dr Andy Kaufman. Steve, the filmaker is a very good friend of mine, he lives in Denmark and is ex pHARMa. A fountain of knowledge. His channel is excellent...Spacebusters." [https://twitter.com/shiftychicken/status/1430817472509251592] Falconer has also done English voiceovers for Stefan Lanka's videos. [https://odysee.com/@spacebusters/Final-Lanka-pt-1-Voice-Over] In October 2020, Falconer wrote: "I just struck a deal with Dr Mark Bailey to co-collaborate on turning his recent industry shaking dissertation, 'A Farewell to Virology' into a co-produced Spacebusters feature length film, as I did with Dr Kaufman a few years back." [https://www.facebook.com/permalink.php?story_fbid=pfbid0sWR3crjUiHaXFnAisJR5VTGHaAYqP6cGrgMzLW7zVqAJXQfnBy7od2UpQgQnsEUrl&id=100064582006850] A video by Spacebusters from 2019 is titled "Oslo Tech pt 2: Reset evidence Goddess Fall Tartarian Free Energy", and the description of the video says: "A photo tour of Oslo Norway looking into mud liquefaction event reset evidence, the fall of the lunar and stellar goddess cult and rise of the solar cult and the possibility of free Tesla atmospheric energy devices used there in the Victorian age." [https://www.youtube.com/watch?v=Aa94KIEdBug] At time 9:55, Falconer first showed photos of lamps in a park at Oslo, and then he showed a photo of a spire on the roof of a church next to the park, and he said: "At the base of the park sits a church with this strange copper device on top, and all of the buildings around are always the same. Giant space-age antenna made of metal or copper sitting on an octagon geometric base, with some kind of ball on top. You see them in every city around the world. The churches and street lamps always have the same as the buildings - space-age antenna with a ball on top, often with an octagon geometry. Was this some kind of atmospheric plasmic wireless energy system in these cities, not so long ago? You have to wonder if Tesla invented this stuff or just rediscovered it." The same claim that the spires on top of churches are antennas for transmitting free energy has been repeated by dozens of flat earth YouTubers. Do they all really believe it, or are they deliberately spreading false information? JonLevi says that the spires on top of church roofs are "antiquitech" devices. [https://www.youtube.com/watch?v=ivixH0eEZZQ&t=57s] Why do so many flat earth YouTubers connect Tartaria to the topics of mud floods and free atmospheric energy, even though neither was mentioned in Fomenko's books about Tartaria?

## Max Igan, mud floods, and Tartaria

In 2016, Max Igan posted a video where he said that in order to disprove the flat earth theory, he took a compass with him on a flight from Chile to Australia, but then according to Jeranism, "Every time he checked his compass he was getting a southwest reading, which a flat earth would show. And on the on-screen video display on the back of the seat in front of him was showing northwest as a globe would show. He had been asleep for 5 hours, he said, but when he woke up, the plane was showing the portion of the trip as northwest, but his compass was showing a different reading of southwest." [https://odysee.com/@jeranism/max-igan%27s-santiago-to-sydney-flight?t=320] Next in 2017, Jeranism did a 6-hour livestream where he tracked Max Igan's flight the other way from Sydney to Santiago. [https://www.flatearthscience.org/live-flight-tracking-max-igan-qantas-sydney-to-santiago/] In January 2020, Max Igan posted a YouTube video where he said that the earth is flat, and in the same video he also said that his real name is not Max Igan and he had a swastika drawn on his palm (or maybe it was a tattoo which he hasn't shown in other videos). [https://www.bitchute.com/video/afugFIfsRQR8/] The next day he posted another video where he said that the earth is both flat and not flat: "The earth is a globe, yes, the earth is flat, yes, and they can both coexist at the same time. [...] The truth is the earth is flat. And the truth is the earth is globe. It's just depending on your belief, folks, because both are absolutely true." [https://www.bitchute.com/video/64tpPF2xaTo/, time 5:52] However a few days later, he said that he was being targeted with mind control technology and that he doesn't actually believe in flat earth: [https://www.youtube.com/watch?v=8Um4uSmTaIY&t=7s] > I had some weird stuff happened in the last couple of weeks. I got targeted folks. I had some sort of a weird thing happen, and I got targeted. I guess I was making too much of a difference with my fire videos, and so they hit me with something. I was lying in bed, and they hit me with something, and they filled my head full of all this rubbish. And I haven't really known what's been going on for the last couple of weeks. It's been crazy, it's been really crazy. And I have no reference point with how to deal with this. You know, I tried to post some stuff online to show you what was happening to me, and what I was going through. I thought it was important for people to see. I've actually received a lot of messages from people who have gone through similar things as well, a lot of people who know I'm not crazy. But the point being folks, they hit me with something. I just underwent a coordinated attack. They hit me with some sort of a light. Had I been asleep when that hit me, I would have literally woke up in the morning thinking I'd had an epiphany, that I was the second coming, and the earth was flat. And that's kind of what I was feeling anyway, and I had this overwhelming impulse that I had to post this online. It was crazy. But all the way through it, I'm thinking, but this is technology, this was technology, you know. My fortunate part about it - like you know, what I find to be fortunate is - I was awake when I saw this coming and hit me. But we all hear about these things, we hear about these directed beams, and we hear about mind control, all sorts of stuff. But we never really think it's going to happen to us. Well that's just what happened to me folks. And it's literally taken me two weeks to work through this. But I'm fine, I'm gonna be back, I'm gonna be doing more fire videos. I don't think the earth is flat. On August 31th 2018, Max Igan posted a video titled "Systemic Coercion" where talked about mud floods, he promoted the mud flood and flat earth YouTuber Philipp Druzhinin, and he said that "the model that we are presented with for the earth being the globe that we're told it is is completely wrong": [https://www.bitchute.com/video/rSo22py0aRSN/] > (15:25) The concept of them hiding history, and the concept that the history we've got now being patently false, and really only sort of started two-three hundred years ago really becomes a distinct possibility when you start looking at the evidence. The reason I've been talking quite a bit about the mud flood that I became aware of when I was in Europe - when I was in Harlem, in Holland - when I saw a couple of those buildings that had these extra structures below the foundations. And then when I searched and I found that there were a lot of people exposing this on YouTube as well - and particularly one Russian guy - if you want to find out about the mud floods, you'll find a channel by a man called Philipp Druzhinin - I think is the name of the channel - I'll put a below in the description of the YouTube version of this. I actually may contact him, and we may have a chat with him, possibly even have him on the show - just simply haven't had enough time. But quite an interesting character. And he's put a lot of research into finding where this mud flood exists across Europe, and you'll get a great deal of information from his channel. I think he may be a flat earther, so don't hold that against him. You'll still find a lot of good information regarding this mud flood on his channel. > [...] > (17:35) You know, this is what the flat earthers believed. They have so much ammunition, because the model that we are presented with for the earth being the globe that we're told it is is completely wrong. I'm not saying the earth is flat, because I've done experiments myself which show curvature to be there. But even with that, none of the models we are given are correct. The globe model that we're given is in no way correct. I myself have had compass anomalies when I've flown on flights - only 10 degrees out or something - but still 10 degrees out is 10 degrees out. Of course it does depend on where you sit on the plane, the metal of the plane affects the compass, blah blah blah. Even metal in ships affects compasses, so it's a kind of an unreliable experiment. But still things are not what we're told. But an interesting thing you know, if you look at a map of the earth, it simply doesn't add up to be what we're told it is. When you really look at it, there is every indication that they are hiding land, and there's somewhere else that exists on this earth that we simply don't know about, because we have not been told that it's there. Later in 2018, Max Igan began to post several videos about mud floods and Tartaria. [https://twitter.com/search?q=%28max+igan+tartaria+until%3A2019-1-1%29+OR+%28max+igan+mud+flood+until%3A2019-1-1%29&f=live] Around the same time, the subjects of mud floods and Tartaria began to be promoted by a huge number of flat earthers, and many flat earth YouTubers even switched the main focus of their channel to Tartaria or mud floods (including Flat Earth British, Barnabas Nagy, captain kirk, Richard Lopez, and UAP). The YouTuber "Static in the attic" who has made several videos about mud floods said that "the mud flood subject really got coined by Philipp Druzhinin", and Druzhinin is a flat earther. [https://www.youtube.com/watch?v=N0RtVIks700&t=11m44s] Druzhinin started posting videos about mud floods in 2016, but I didn't find any other channel which had posted videos about mud floods before December 2017. A debunker who investigated the origins of the mud flood phenomenon wrote: "I did find a YouTube user, Philipp Druzhinin, who had been posting videos about a mud flood since August of 2016. At first there wasn't much interest in his videos; they had very low viewership. That is, until December 2018/January 2019 - the same time that Google Trends reported the Internet became aware of the subject. Druzhinin had an enormous spike in his downloads right at that time." [https://skeptoid.com/episodes/4765] I didn't find any reference to mud floods in Anatoly Fomenko's books or on his website. [https://www.google.com/search?q=site:chronologia.org+mud] So I don't know why YouTubers ended up connecting the topic of mud floods to Fomenko's theory of the Tartarian Empire. The YouTubers who make videos about Tartaria often also cover topics like star forts, free energy, giants, "AntiquiTech devices", or a global reset in the 1800s, none of which are discussed in Anatoly Fomenko's books. Or the YouTubers look at photos of architecture from the 1800s or even 1900s and claim that it's Tartarian, even though Fomenko says that the Tartarian Empire collapsed after the Pugachev's Rebellion of 1773-1775. [https://chronologia.org/en/how_it_was/08.html] (It could be that aspects of Fomenko's theory are real, so disinformation agents on YouTube were tasked with creating a more ridiculous version of his theory in order to discredit Fomenko. Even though I believe that Fomenko himself was tasked with discrediting the true aspects of his theory by causing them to be associated with the false aspects of his theory. For example I think Fomenko presented convincing evidence that books by Tacitus which were supposedly discovered during the Renaissance were actually written during the Renaissance. [https://chronologia.org/en/seven/1N07-EN-373-409.pdf] But then that gets discredited because it gets lumped together with Fomenko's easily disprovable claims such as that the dendrochronological record doesn't go back further than the 10th century.) But anyway, below are the oldest videos about mud floods I found on various YouTube channels. Almost all of the channels also have videos about Tartaria, and around half of the channels also have videos about flat earth: - 2016-08-05 - Philipp Druzhinin - "MUD Flood in 19th century. GiANTs were real." (this was the first video on the channel, but later videos also include videos about flat earth) [https://www.youtube.com/watch?v=ETyyIAWDOlI] - 2017-12-14 - The Celtic Tartarian Channel - "FLAT EARTH BRITISH, Stunning Evidence for 'The Mud Flood' /1600's Maps Questions" (the description says "The Video of the mud pictures are from a Russian You Tuber linked"; this channel changed its main focus from flat earth to fake history at this point) [https://www.youtube.com/watch?v=l1lHfCcPBsA] - 2017-12-17 - Bette Swanson - "MudFlood research for a Russian Cowboy. New Pictures, theories!!" (this is actually a video about flat earth which I think doesn't mention mud floods, but the description says that "Another researcher from Russia wanted some Mudflood info") [https://www.youtube.com/watch?v=_zfQ2Qlpwuc] - 2017-12-19 - Phioo wills wissen - "Mudflood" (this is just a 59-second video of a muddy river flowing, but the next video on the same channel is about star forts and mud floods) [https://www.youtube.com/watch?v=5JHWnDWPfa0] - 2018-03-19 - divulge - "Portland Mudflood?" (this is the first video on the channel; other videos include a short video of chemtrails) [https://www.youtube.com/watch?v=QgkAfpWQmPc] - 2018-03-25 - wee flat earther 2 - "Mud flood?!! Bothwell castle" (this is the second video on the channel; the first video is a 33-second video of chemtrails; other videos mention flat earth) [https://www.youtube.com/watch?v=_5Ee5kUuPIE] - 2018-07-01 - rudymarleyaskit - "Mud Flood Evidence. Cadzow Oaks. Scotland" (this is the first video on the channel) [https://www.youtube.com/watch?v=JK8CvkzcW9M] - 2018-07-09 - Flat Water Films - "Egress windows or mud flood" (this is the second video on channel; first video is a 37-second video of a wind chime) [https://www.youtube.com/watch?v=8jqmjlQZ4TE] - 2018-07-23 - CIA are in the comments section to divide us - "The mud flood evidence" (other videos on this channel are about topics like MGTOW or veganism but there's only a few conspiracy videos) [https://www.youtube.com/watch?v=G0InUQeaw18] - 2018-07-28 - Hoppy Hippie - "Greenock Mud Event Evidence?" (this channel also has videos about flat earth) [https://www.youtube.com/watch?v=iQuPxGTLjqg] - 2018-08-24 - LIFE KREATIONZ by David Wells - "Staged Reality Part 1 - Once Upon a Muddy Time... Desolated Streets on a False Epoque..." (this is a channel with several videos about Finnish topics or with Finnish subtitles; narrated by someone with a Russian or Slavic accent) [https://www.youtube.com/watch?v=0JJKIPOn3u4] - 2018-09-02 - Loagun - "Mudflood 1: and there was no man to till the ground..." (this is the first video on the channel) [https://www.youtube.com/watch?v=bcDT_gDngxw] - 2018-09-20 - JonLevi - "Mud Flood Questions" (this is probably the most popular channel that follows the mud flood and Tartaria formula; other videos are about star forts, free energy, and giants) [https://www.youtube.com/watch?v=I0H4O-Xdu7M] - 2018-09-22 - UAP - "1595 - 1611 Orbis Geographica Mud Flood" (this channel changed its main focus from flat earth to fake history in late 2018) [https://www.youtube.com/watch?v=zr3PJObXfvw] - 2018-09-24 - Jon Boye - "Mud flood Athurlie house Barrhead Glasgow under mud??" (this channel only has 30 subscribers; most other videos are things like a 30-second video of a river which require minimal effort to fill up a channel) [https://www.youtube.com/watch?v=POGKVVnK-A4] - 2018-10-13 - Larbi Benameur - "Mud flood- Aghamat ,Morocco" (other videos on this channel are about topics like Tartaria and Moorish architecture) [https://www.youtube.com/watch?v=VHMFQrPk9qw] - 2018-10-18 - Global vision - "Distortion of History. Observing Sri Lanka. Part 1" (the video also discusses mud floods) [https://www.youtube.com/watch?v=HDpFcjgpb04] - 2018-10-18 - Richard Lopez - "Mud Floods The Untold Story About Our History #Mudflood" (this channel changed its main theme from flat earth to fake history around this point) [https://www.youtube.com/watch?v=Q9IOhkUT9IA] - 2018-11-13 - baltimore fats - "Brewing up a Mud Flood" (this is the first video on the channel) [https://www.youtube.com/watch?v=_W3pOkD6wRw] - 2018-11-14 - aeon-aton - "Mud flood/Subterranea investigation walkabout: Priory Park/Lane; Chichester." (virtually all videos on this channel are either musical performances or videos about mud floods) [https://www.youtube.com/watch?v=-PWIf7KYdKQ] - 2018-11-15 - dziad WSZEWIED - "manufaktura d MUD FLOOD jako przykad budynku przedpotopowego" (this channel also has videos about Tartaria) [https://www.youtube.com/watch?v=PjzwzHnSguI] - 2018-08-31 - thecrowhouse - "Systemic Coercion" (in this video Max Igan mentioned mud floods and Tartaria, promoted Philipp Druzhinin, and said that the earth is neither flat nor a globe) [https://www.youtube.com/watch?v=cKUH2kSiJhw] - 2018-11-25 - trouble about - "Paris Catacombs - Mudflood - Flat Earth" (this channel also has many videos about flat earth) [https://www.youtube.com/watch?v=8fDG7JufLEU] - 2018-12-02 - pexheliocentric - "Mud Flood Cincinnati - a Juicy bit of Evidence" (the main focus of the channel switched from flat earth to mud floods and Tartaria after this video; other videos are about 5G and chemtrails) [https://www.youtube.com/watch?v=sCEBtgZsvts] - 2018-12-06 - Andreas Xirtus - "California Tunguska Tartaria Mudflood Apocalypse of 1812" (this is the first conspiracy video on the channel) [https://www.youtube.com/watch?v=ga30MkrRZis] - 2018-12-15 - captain kirk - "Very curious and very famous journeys made in Muscovy, Tartary, and Persia" (the main focus of this channel changed from flat earth to fake history after this video) [https://www.youtube.com/watch?v=n3rvJqVUCnw] - 2018-12-18 - Barnabas Nagy - "Mud Flood Proof: Windows Below Ground Level, HISTORY IS A LIE" (this channel changed its main focus from flat earth to Tartaria after this video) [https://www.youtube.com/watch?v=39_Ok5IDFjs] - 2018-12-18 - The Earth's History was Confusing - "Brisbane Qld Australia, buildings Past Possible Mud Flood." (the first video on the channel; other early videos are about 5G, star forts, and Australian wildfires being caused by DEWs, which are all subjects that have been covered by Max Igan) [https://www.youtube.com/watch?v=kT04xfzSfpk] - 2018-12-25 - Steve Matthews TeethofTheLamb - "Introduction to Mud Flood" (primarily a flat earth channel) [https://www.youtube.com/watch?v=7Lbl2EIHs9U] - 2018-12-30 - Cyx Reset - "#mudflood #tartaria #cyxreset Awakes Time" (earlier videos include videos about flat earth; most videos on the channel are short videos that require minimal effort to produce, like aerial drone footage or recordings of video games) [https://www.youtube.com/watch?v=JDXmqPhtibQ] - 2019-01-01 - Static in the attic - "1812 RISE OF THE N.W.O. HIDDEN IN PLAIN SIGHT!!! DOCUMENTED HISTORIC PROOF!!!" (first video on the channel; mentions mud floods at time 1:08:16) [https://www.youtube.com/watch?v=XD1xRBtjqHg] - 2019-01-03 - Observation Deck - "GLOBAL MANDELA EFFECT: Mud Flood, Tartaria & Nikola Tesla" (the main topic of this channel used to be Qanon but the videos about Q are now hidden or deleted) [https://www.youtube.com/watch?v=DP0qV2DN3mo] But anyway, I think there is a network of disinformation agents which was employed to popularize the flat earth psyop in 2015, and it was later employed to popularize the conspiracy theories about Tartaria and mud floods in 2018, and next in 2020 members of the same network were given the script to promote the theory that viruses are not real. The flat earth, Tartaria, and no-virus theories had all existed in some form before they were picked up by the network, but the network helped to popularize them among the masses on YouTube. And I think the same network also includes people like Max Igan and Sofia Smallstorm, who are not generally known as flat earthers but who are still linked to the flat earth network, or who have only occasionally said that they believe in flat earth or who pretend to be agnostic about flat earth. When I searched Twitter for `funeral director clot until:2021-9-30`, the oldest tweet I found which referred to a funeral director saying that COVID jabs caused blood clots was a tweet from July 2021 which said: "my daughter is a funeral director and has lately had a few deceased who otherwise healthy (weight, diet) have died from the Astra Zeneca jab causing blood clots." [https://twitter.com/GillBridgestock/status/1415775446621429761] However the second-oldest tweet was a link to an interview that John O'Looney did with Max Igan which was mirrored to BitChute by Jim Fetzer. [https://twitter.com/Mykul0rr/status/1438441722653052932] John O'Looney is one of the funeral directors who were featured in the Died Suddenly film whose main theme were the kalamari clots. The film was directed by Nicholas Stumphauzer who also directed the Watch the Water film, where Bryan Ardis claimed that COVID was caused by snake venom in tap water, and both films premiered exclusively on the Stew Peters Network. Jane Ruby brags that she was the first to break the story about the kalamari clots in January 2022 when she interviewed the funeral director Richard Hirschman. [https://x.com/RealDrJaneRuby/status/1619624953036558338]

## Sofia Smallstorm and Jim Fetzer

Apart from Max Igan, Sofia Smallstorm was another early promoter of the no-virus theory who is linked to flat earth. In the year 2015 when the flat earth psyop was first popularized, Smallstorm did an episode about flat earth on her podcast, and she has since then done interviews with several flat earthers, including DITRH (David Weiss), Flat Earth Podcast, Jeranism (Jeran Campanella), Sague of Quay (Mike Williams), and The Daily Plane. [https://twitter.com/search?q=sofia+smallstorm+flat+earth&f=live] In an interview with the flat earth channel jeranismRAW in 2018, Smallstorm said that she is agnostic about flat earth or that some aspects of the flat earth model are plausible: "I think it's very plausible that the toroidal thing of the different - the different worlds - lands, as David and I call them - beyond the Antarctic ice wall, and their own suns and moons, which supposedly are what we call our planets. But this star thing has to be wrapped above and around all of that. It's not just a flat layer. So whether the earth is flat or not, I can't tell you, but it is definitely some kind of interior - central interior to many layers which I would call dimensions." [https://www.youtube.com/watch?v=NjCWADmMJJc&t=38m37s] (By David she probably meant David Weiss, who has said that he was first turned into a flat earther in 2015 by Smallstorm.) On March 23rd 2020 local time, Sofia Smallstorm appeared as a guest in an episode of the jeranismRAW podcast, where the other two guests were David Weiss and Jason Lindgren, and where Smallstorm talked about how viruses are excreted by the body to clean out cellular debris, and she talked about Arthur Firstenberg's book _The Invisible Rainbow_ and about how flu is not a viral disease. [https://www.youtube.com/watch?v=cstuEFrcjTI] In May 2020, Kaufman posted an interview with Smallstorm on his YouTube channel. [http://web.archive.org/web/20200626144429/https://www.youtube.com/watch?v=xUtPjSfPo-g] Around the same time, Smallstorm did interviews about virology with the controlled opposition outlets SGT Report and Israeli News Live. (Israeli News Live consists of Steven Ben-Nun and his wife Jana. Steve has said that he's a former CIA agent, and he has said that his father was a ship captain who smuggled drugs for the U.S. government. In early 2020, he started saying that the debris field surrounding Planet X would begin to impact the Earth in late 2020 or early 2021 and that most humans on Earth would die soon afterwards. In 2020, he also spoke in several conferences about Planet X together with his friend John Moore, who says that he is a former intelligence analyst for the U.S. government. In the 2017 Flat Earth International Conference in San Diego, Steve and Jana hosted a debate about flat earth between their friend Stephen Pidgeon and the flat earther Zen Garcia, during which Zen Garcia said that "the gospel was written and delivered to the apostles and the prophets by the Designer - the Grand Architect". [https://www.youtube.com/watch?v=-pWU2PsmQbU&t=51m30s]) In 2006, Sofia Smallstorm released the 9/11 documentary _911 Mysteries Part 1: Demolitions_ under her real name Sofia Shafquat, but she was sued by Rick Siegel because she used his 9/11 footage without permission, and she manipulated the footage in several ways which included adding the sound of explosives to support her theory of a controlled demolition, and she edited together footage of the North Tower and South Tower and misrepresented it as footage of the South Tower. [http://web.archive.org/web/20070225192729/www.911researchers.com/node/114] Then after the court ruled in Patrick Siegel's favor, Smallstorm disappeared from the conspiracy scene for a while, but she later re-emerged under the name Monica Smallstorm which she next changed to Sofia Smallstorm. Her profile on the website of "Women Writers Initiative Pakistan" said that she was born in Karachi, Pakistan, and the description of her novel from 1993 says that she is a cousin of Salman Rushdie. [https://i.ibb.co/xhp9JFy/sofia4.jpg, https://www.amazon.com/Shadow-Man-Novel-Sofia-Shafquat-ebook/dp/B01BM0H0EA] (However she doesn't look Pakistani, so she might be an ethnic Jew who was born in Pakistan or something, because Salman Rushdie is also suspected to be a crypto-Jew. Smallstorm is not even a native speaker of English, because she has said that she spoke English with a heavy accent when she moved to America around the age of 18 or 20 - I don't remember the exact age.) In an interview in 2007, Smallstorm mentioned that she moved around a lot as a child, and when she was asked if her family was military, she answered that "we're going to move on now". [http://hugequestions.com/Eric/Hufschmid-14Sept2008.html] In her documentary "Unraveling Sandy Hook", Sofia Smallstorm promoted the same kind of easily debunkable disinformation as Jim Fetzer. [https://www.spingola.com/Unraveling1.html, http://www.sandyhookfacts.com/2015/11/ten-reasons-jim-fetzers-sandy-hook-book.html] For example her documentary featured a video clip where she claimed that people were walking multiple times in circles around the Sandy Hook school, but the video just consisted of a clip of people walking around the school once which was looped multiple times. [https://odysee.com/@bitjesus/Sofia-Smallstorm-Unraveling-Sandy-Hook, time 54:12 to 55:04] In July 2020, Fetzer did an interview with Smallstorm where she said that viruses are exosomes. [https://www.bitchute.com/video/5ECQnAs64rnP/] Next in August 2020, Fetzer mirrored videos about the no-virus theory by Max Igan and Sofia Smallstorm on his BitChute channel. [https://www.bitchute.com/video/1OcKZxuTvY5u/, https://www.bitchute.com/video/fLYP1dus3DJV/] And then afterwards Fetzer's BitChute channel has also mirrored several videos by people like Tom Cowan, Andrew Kaufman, and Amandha Vollmer. So Fetzer and Smallstorm have basically promoted the same type of disinformation first about 9/11, then Sandy Hook, and then COVID. Fetzer and Smallstorm both claimed that the Sandy Hook school had been closed for several years before the shooting. One of their arguments was that there were no new snapshots for the school's website at web.archive.org between 2008 and 2013, but that's because the lines `User-agent: *` and `Disallow: /` were added to the `robots.txt` file in 2008. [https://www.metabunk.org/threads/debunked-full-proof-sandy-hook-was-closed-5-yrs-ago.3236/, https://web.archive.org/web/20080604014943/http://www.newtown.k12.ct.us/robots.txt] C. W. Wade has posted links to PTA meeting minutes of the Sandy Hook school, a school handbook of the 2010-2011 school year, an enrollment report as of November 30, 2012, a 2012-2013 school calendar, a budget approved by the board of education approved for 2012-2013, and so on. [http://www.sandyhookfacts.com/2014/07/sandy-hook-hoax-claims-debunked.html] There's also old tweets which refer to various activities at the school in the year 2012 and earlier. [https://twitter.com/search?q=sandy+hook+elementary+until%3A2012-12-13&f=live] Fetzer ignores the evidence that the videos of the planes hitting the Twin Towers are fake, but he claims that the videos are real and the planes are holograms. As evidence for his hologram theory, Fetzer keeps showing a screenshot of an old military website which has a page about an "Airborne Holographic Projector" which "can be used for psychological operations and strategic perception management". [https://odysee.com/@BrianRuhe/911-Who-was-Responsible-and-Why---Jim-Fetzer,-Ph.D, time 1:17:42; http://web.archive.org/web/20010621172648/maxwell.af.mil/au/2025/volume4/chap03/b5_6.htm] However the website was part of a program called "Air Force 2025", where students and faculty members of the Air University at the Maxwell Air Force Base were asked to imagine what technologies would be used by the Air Force in the year 2025. [http://web.archive.org/web/20010602050617/http://www.maxwell.af.mil/au/2025/] Fetzer says that the screenshot is from an "Australian military manual" because the URL of the website features the directory name `/au/`, but actually the AU stands for Air University. Joel from Aryan Empires has shown that the Sandy Hook hoaxers like Fetzer and Smallstorm were collaborating with the anti-hoaxers, where one side manufactured false conspiracy theories that were easily debunked by the other side, and where both sides ignored the genuine anomalies which have been found by researchers like Joel and JFK371, where both sides were full of people who were linked to law enforcement or the military or who were felons or on probation. [http://aryanempires.blogspot.com/search/label/Jim+Fetzer, http://aryanempires.blogspot.com/2020/07/sandy-hook-covenant-live-chat-guest-jfk.html]

## David Weiss and Timothy Rothschild

David Weiss is also known as DITRH, Flat Earth Dave, and Rabbit Hole Dave. In 2015, he did a debate with Jim Fetzer about whether the earth is flat or not. [https://www.youtube.com/watch?v=yIuLU8asI-8] (So that's yet another indication that in the case of the flat earth debate, the conspiracy advocates and the skeptics were hired from the same pool of disinformation agents, just like was the case with Sandy Hook.) In 2014 before Weiss had become a flat earther, Jim Fetzer interviewed him and Nathan Folks about the Boston marathon bombing. [http://radiofetzer.blogspot.com/2014/10/nathan-folks-david-weiss.html] At the time Nathan Folks was a producer and talent manager at Hollywood. He first came out as a skeptic about the Boston bombing in a radio interview he did with Voice of Russia, and Dr. Eowyn wrote an article based on the interview. [http://web.archive.org/web/20140504050624/fellowshipoftheminds.com/2014/05/01/hollywood-producer-nathan-folks-says-boston-bombings-a-false-flag/] In 2014, the National Geographic published a documentary called _Inside the Hunt for the Boston Bombers_, where the cast of actors included someone named David Weiss who played the role of Jeffrey S. Salley. [https://www.avclub.com/film/reviews/inside-the-hunt-for-the-boston-bombers-2014] At IMDB, the actor in the movie doesn't have the same profile page as the flat earther David Weiss, but if they're actually the same person then I guess David Weiss is yet another flat earther who has also worked as an actor. [https://www.imdb.com/title/tt3660486/fullcredits] In 2015, David Weiss and Peekay Truth were interviewed about the Boston bombing by John B. Wells. [https://marcellee.com/?p=91921] Peekay's real name is Peter Kusznir and he played minor roles in two Australian films. An article from 2017 said: "Actor Peter Kusznir has been reported of 'repeatedly impersonated and vilified the friends' of 10-yr-old Thalia Hakin who was killed in Melbourne's Bourke St tragedy in which a driver ploughed allegedly intentionally into pedestrians." [https://www.jwire.com.au/jccv-appalled-about-actors-vilification-of-the-family-and-friends-of-thalia-hakin/] Peekay is also a Sandy Hook hoaxer, and C. W. Wade wrote that Peekay "stalked and harassed victims of the Boston Bombing, Sandy Hook, and the Nice truck attack" (so he may have been tasked with harrassing the Sandy Hook families in order to make conspiracy theorists look bad). [https://www.sandyhookfacts.com/2017/02/restraining-order-issued-to-hoaxer.html] In 2016, David Weiss said that Peekay "has stayed on the sidelines from the flat earth - Peter. Well, neutral - I think he's leaning over the flat side, but he doesn't want to jump over the fence yet because he's afraid." To which Peekay answered: "I'm just gonna get out of the closet here. Look, yeah, look, you want me to say my opinion on the flat earth. Look, I'll just put it this way, simply. If I had a choice, if my life depended on it, I would say the earth is flat." [https://www.youtube.com/watch?v=uyGLNs3yMDc&t=3m8s] In 2020 on his YouTube channel, Peekay mirrored a video about flat earth by David Weiss. [https://www.youtube.com/watch?v=ivrj8Q1QbMg] In 2021 in an interview with Jim Fetzer, Peekay said that the SARS 2 virus does not exist. [https://www.bitchute.com/video/hvPoeYdeWpMe/, time 6:18] In 2014, Fetzer also did a second podcast where he interviewed David Weiss, but this time Weiss was accompanied by Timothy Rothschild who used to be the co-host of his podcast. [http://radiofetzer.blogspot.com/2014/02/] I found an article which said that it was Rothschild's idea to start the podcast, and that Weiss was first turned into a flat earther by Sofia Smallstorm: [https://theunexpectedcosmology.com/globe-proof-deep-inside-the-rabbit-hole-with-david-weiss-and-the-flat-earth-awakening/amp/, https://theunexpectedcosmology.com/wp-content/uploads/2020/05/the-unexpected-cosmology-pdf.pdf] > Weiss and Timothy Rothschild met while working together at a company, the name of which, Weiss insists, is not necessary to the narrative. It was during lunch hour that their career in conspiracy theory, or what Weiss refers to as "truth seeking," unofficially began. Here Weiss recalls, "We'd be talking about the Federal Reserve and how it's not real money, and it's a private bank, and nobody believed us." > [...] > Initially, DeepInside the RabbitHole was Rothschild's idea. "Tim had a good friend who offered the opportunity for us to do a show with him. Stand Up NY Labs was a podcast studio in New York City, and they were looking for something conspiracy minded." > [...] > In the third year Weiss began receiving messages from flat earthists. "I started banning people from our social media for repeatedly saying such stupid things. And I wouldn't even look into it, and then one day I was speaking with Sofia Smallstorm, who made one of the first 9/11 movies, called _911 Mysteries_, and we became friends, and we were talking about how there were a whole bunch of hoaxes and events that were happening." > Weiss said: "It's amazing how much deception there is in the world," > And then Smallstorm said: "Oh David, it's worse than that." > _I think the earth could be flat._ > "I was bowled over," Weiss recalled. This - coming from a fellow researcher whom he had so much respect for. "I had just spent twenty minutes banning a bunch of people from social media." > _What do you mean the earth is flat?_ > Smallstorm sent him an assortment of video links, and one of them was Mark Sargent. After stumbling upon Eric Dubay's _200 Proofs that the Earth Is Flat_, Weiss had had enough. > _That's it. I'm going to debunk this._ > "And for the next two weeks I researched every hour of every day that I had available to disprove - just come up with one proof that the earth is a ball. That's all you need, just one." Weiss paused over the phone. "And I couldn't do it." It's interesting that the podcast was recorded at the studio of a stand up comedy club. Eddie Bravo started talking about flat earth on Joe Rogan's podcast around August 2015, which was probably where a lot of people first heard about flat earth. [https://twitter.com/search?q=eddie+bravo+flat+earth+until%3A2016-01-01&f=live] I found a Timothy Rothschild on LinkedIn whose job position is listed as co-host at Stand Up NY Labs since 2013. [https://www.linkedin.com/in/timothy-rothschild-98011614/] His location is set as Tappan, New York. Under the section for education, there's an entry for "Mystery School" where he studied the major of "Healer, Energy" from 2013 to 2017. In an old episode of the DITRH podcast, the description says that Rothschild's full name is Timothy Paul Rothschild. [https://podtail.com/podcast/deepinside-the-rabbithole/the-trial-of-tim-rothschild/] When I googled for `"timothy p. rothschild"`, I found an entry for Timothy P Rothschild whose current address was in Tappan, and other persons linked to the address were listed as Britta K Rothschild and Robert T Rothschild. [https://www.officialusa.com/names/Timothy-Rothschild/] By googling for `britta robert rothschild`, I found an obituary for Tim's brother which said: "Rob is survived by his mother, Britta and his father, Robert; stepmother, Linda; his sisters, Sabrina and Naomi and his brother, Tim; and his grandparents, Bob, Ruth, Bill and Alma". [https://www.legacy.com/us/obituaries/lohud/name/robert-rothschild-obituary?pid=149533226] However unexpectedly the obituary said that Tim Rothschild's brother was given a "Mass of Christian Burial" at St. Catharine's Church. (According to Forebears.io, there are over 5,000 people with the surname Rothschild in the United States, and their average salary is only about 30% higher than the average national salary, so I guess not all of them are elite bankers. [https://forebears.io/surnames/rothschild]) David Weiss used to have a Facebook page called "Exposing The Big Three" which was about 9/11, Sandy Hook, and the Boston Bombing. In 2014, _Veterans Today_ published an article by Dr. Eowyn which said that Wolfgang Halbig lectured to a room of nearly 200 Oath Keepers about Sandy Hook and he managed to convert many of them into hoaxers. [http://web.archive.org/web/20150919001439/http://www.veteranstoday.com/2015/05/01/cia-spy-confirms-sandy-hook-and-boston-bombing-false-flags/] The article included a photo where Halbig posed together with David Weiss and Tim Rothschild who both accompanied him to the meeting. Dr. Eowyn's article was based on notes about the event that were written by Weiss, and the article mentioned that "I (David Weiss) met Wolfgang after his first interview (with Dave Gahary) to go viral on YouTube. I helped him set up a PayPal account, which he had no idea how to do and later his GoFundMe crowd funding account." Brendan Hunt wrote that Weiss was also the administrator of Halbig's Facebook page. [http://web.archive.org/web/20160301161558/www.xrayultra.com/news/sandy-hook-troll-wars-trilogy] In 2014 when someone filed a copyright claim against a video by Halbig, Halbig's associate Thomas Lapp told them that "I thought David Weiss got this sorted out with you." [http://www.sandyhookfacts.com/2014/12/sandy-hook-justice-hit-with-another.html] (According to the Government Oversight and the Organized Crime and Corruption Reporting Project, over 300 current or former employees of the DHS or its subagencies were self-identified members of the Oath Keepers. [https://www.wsws.org/en/articles/2022/12/15/ruit-d15.html]) Dr. Eowyn is a Sandy Hook hoaxer who wrote three chapters in Fetzer's book about Sandy Hook. In 2016 it was revealed that her real name is Maria Hsia Chang. [https://www.crisisactorsguild.com/2016/01/18/who-writes-this-shit-who-is-dr-eowyn/] The description of her book about the Falun Gong says: "Maria Hsia Chang discusses the Falun Gong's beliefs, including their ideas on cosmology, humanity's origin, karma, reincarnation, UFOs, and the coming apocalypse. She balances an account of the Chinese government's case against the sect with an evaluation of the credibility of those accusations. Describing China's long history of secret societies that initiated powerful uprisings and sometimes overthrew dynasties, she explains the Chinese government's brutal treatment of the sect." [https://www.amazon.com/Falun-Gong-Maria-Hsia-Chang/dp/0300196032] Her other books and academic papers basically promote the line of _The Epoch Times_ on East Asian policy. She taught at the University of Nevada, and her old bio on the website of the university said that she "is a lecturer for the U. S. Department of Defense's Joint Counterintelligence Training Academy, as well as the U. S. Marine Corps War College". [https://web.archive.org/web/20070104091632/http://www.unr.edu/cla/polisci/famaria_hsia_chang.htm] In Dr. Eowyn's book about Falun Gong, she gave thanks to "my husband, Professor A. James Gregor". Dr. Eowyn's husband was named to the Oppenheimer Chair of Warfighting Strategy 1996-1997 at the Marine Corps University, he was was the co-founder of the International Association for the Advancement of Ethnology and Eugenics, and he was an advisor to the Filipino leader Ferdinand Marcos. [https://en.wikipedia.org/wiki/A._James_Gregor] His first book was about Marxism but he later specialized in Fascism, which he said was "a variant of classical Marxism" and that the Italian "Fascists were almost all Marxists - serious theorists who had long been identified with Italy's intelligentsia of the Left". [ibid.] But anyway, it's interesting that Dr. Eowyn and her husband were affiliated with the Marine Corps, because Fetzer was also a 2nd Lieutenant in the Marine Corps, and Dave Gahary described himself as "a former submariner in the U.S. Navy". [https://www.d.umn.edu/~jfetzer/, https://americanfreepress.net/afp-podcast-sofia-smallstorm-talks-sandy-hook/] Gahary was listed as the principal officer of Fetzer's publishing company Moon Rock Books. [https://www.cbsnews.com/news/sandy-hook-lawsuit-lenny-pozner-father-of-boy-killed-wins-defamation-suit/] In 2014, Keith Johnson wrote that Wolfgang Halbig "was launched onto the public stage last February through a compelling interview with AMERICAN FREE PRESS reporter Dave Gahary". [https://americanfreepress.net/web-exclusive-is-wolfgang-halbig-on-a-wild-goose-chase/] Jim Fetzer, Wolfgang Halbig, and Gahary visited Sandy Hook in 2014, and there's photos of them standing outside the Newtown Police Department. [https://www.wolfganghalbig.com/wp-content/uploads/2011/09/Wolfgang_Halbig_Hoax_Of_a_lifetime.pdf, page 146] David Weiss has a website where he posts links to videos he has mirrored on BitChute, and he also posts links to BitChute videos on other channels. In 2018 he posted a BitChute video about Falun Gong by China Uncensored which was basically an advertisement about how great Falun Gong is. [https://stoplookthink.com/2018/06/28/what-is-falun-gong-china-uncensored/] Wikipedia says this about China Uncensored: "Until 2020,[citation needed] the YouTube show was compiled into longer 30-minute episodes aired by New York–based New Tang Dynasty Television, which is affiliated with Falun Gong, a new religious movement banned in China.[2][4] NTD added Chinese subtitles to these longer episodes and broadcast them into mainland China.[4] Vox has described the show as an affiliate of 'The Epoch Times's media empire'.[5]" [https://en.wikipedia.org/wiki/China_Uncensored] In 2023 when Harry Vox did a debate with Giuseppe Vafanculo about whether Handsome Truth was a fed plant or not, Dave Gahary joined the debate to defend Handsome Truth, even though HT's Goyim Defense League is the most obvious fed operation like Vox argued. [https://www.bitchute.com/video/kA1Sl3cNaI4j/] Gahary was the webmaster for American Free Press, which was the successor of the Spotlight magazine which was published by the Liberty Lobby, but Eustace Mullins, L.T. Patterson, and Christopher Bollyn have all said that Liberty Lobby was covertly controlled by the communist Jew Mark Lane. [https://www.bollyn.com/the-liberty-lobbys-mark-lane-and-the-jonestown-massacre/, https://altcensored.com/watch?v=HGPmuIaNbAQ] (However Bollyn is not necessarily a reliable source, because he lived on a Zionist kibbutz in Israel, he married the Jew Bosmat Merimsky who Bollyn said worked for Israeli intelligence, his sister Karin Marta Bollyn married the Jew Michael Epstein, and in 2001 Bollyn's sister was listed as a new trustee of the Temple Solel synagogue in Arizona. [http://takeourworldback.com/bollynhufschmidmurdoch.htm, https://www.bollyn.com/the-law-of-the-jungle-the-jews/, http://www.takeourworldback.com/short/bollynisraeliwife.htm] But on the other hand it also says a lot about AFP that their star investigative reporter was Christopher Bollyn.) In 2022, Tim Rothschild appeared as a guest on a podcast called "Ascension of the Chessmen". [https://ivy.fm/tag/tim-rothschild] The logo of the podcast features a man with wings hovering over a floor with Masonic checkerboard tiling, which doesn't even look like a chessboard because it has the wrong number of squares. The 11th guest of the podcast was described as "B, a wealth of knowledge into the occult, freemasonry & spirituality", the 16th guest was described as a "former master mason", and the 21st guest was described as "a passed Master Freemason". [https://podcastaddict.com/?podId=2645454] The 26th guest was Jason Lindgren (Secrets of Saturn), the 29th guest was Lindsey Scharmyn (Rogue Ways), the 35th guest was David Weiss, the 40th guest was the rapper ODD TV who is a flat earther, the 47th guest was Tartaria and mudflood YouTuber Andreas Xirtus, the 50th guest was Benjamin Balderson, the 64th guest was Crrow777, and the 137th guest was Marty Leeds. So I was surprised to not see Kaufman or Cowan on the list. Tim Rothschild's website says that he is a Kabbalistic healer: "As a Nondual Kabbalistic Healer, philosopher, numerologist, broadcaster and writer, Tim has ventured through the paranormal, conspiratorial, and mystical realms only to begin to understand what it means to awaken to our true nature, and live it within the Great Mystery. The core of his healing work revolves around integration of a Nondual approach to the Kabbalistic Tree Of Life as well as the Kabbalistic Universes of Consciousness, allowing the individual to come into relationship with reality as it is. The integration of this particular healing and awakening work opens the door for more possibility and potential to unfold holographically, that is, everywhere and in everything. He is a graduate of A Society of Souls, and continues this work through Advanced Studies Groups, Teacher Training programs, as well as a nondual approach to intimacy. He is also a practitioner of the MAGI process, Impersonal Movement 1 and 2 and the Work of Return. Tim is an apprentice in the 4 year ASOS class in the United Arab Emirates." [http://www.thethirdthing.net/] The MAGI Process, Impersonal Movement, and Work of Return are all trademarks of Jason Schulman, who calls himself a Kabbalist healer and founded A Society of Souls. [https://books.google.com/books?id=BBmC04nf0oYC&pg=PA163] So when Rothschild's LinkedIn profile says that he studied healing and energy at a mystery school from 2013 to 2017, I guess he meant the 4-year program by A Society of Souls. When David Weiss was asked in a YouTube comment who Tim Rothschild was, he replied: "Tim was my friend that I worked with in the corporate world at Mercury Solar Systems. Tim was adopted and his parents have the name Rothchild [sic] but were middle class people with ZERO connections to anything. They lived in a small house in Nyac NY. There are millions of people named Rothchild that have no connection to anything." [https://ifers.forumotion.com/t369-david-weiss-exposed#18570] An article from 2011 said that Tim Rothschild was a sales representative for Mercury Solar Systems which installed solar panels. [https://www.liherald.com/stories/taking-the-step-toward-solar-power,31409?page=1] (So I guess it's possible that he's just an average guy even though he's a Kabbalist named Rothschild who was educated at a mystery school.) On March 18th 2020 UTC, David Weiss posted a clip of a video he did with Owen Benjamin, where Benjamin said: "I think it's the corona, if you just "-ry", it's coronary. I think it's a virus of the heart, like I think it's a spiritual release. Thoughts?" Then Weiss answered: "Viruses are the cleanup mechanism in your body. If there's a dead animal on the road, the vultures come and the rodents come, and that's nature's cleanup mechanism. When you have diseased cells in your body, the viruses and bacteria come to clean it up. You don't - you know, viruses and bacteria do not cause illness. They protect you from illness." And then Owen Benjamin replied "Exactly." [https://www.bitchute.com/video/zXnbwPC4bSiI/, time 14:30] On March 18th David Weiss posted a link to a video by RussianVids titled "Yet Another 33 Reasons Why The Novel Coronavirus is FAKE". [https://stoplookthink.com/2020/03/18/yet-another-33-reasons-why-the-novel-coronavirus-is-fake/] RussianVids is also a flat earther, and he has made an video titled "4 Hour FLAT EARTH Documentary". On March 23rd 2020 UTC, David Weiss posted a video on YouTube where Aajonus Vonderplanitz said that viruses are "soaps, they are solvents. The body makes them to dissolve tissue in your body that are too toxic for the parasites, the bacteria, and the fungus to eat." [https://www.youtube.com/watch?v=1edeMsLFDnI&t=2m11s] In June 2020, DITRH mirrored a video by the undercover nurse Erin Marie Olszewski. Olszewski wrote that she used to work at a secret anti-terrorism unit at the MacDill Air Force Base. [https://books.google.com/books?id=Dn_rDwAAQBAJ&pg=PT91] MacDill is the location of the headquarters of Special Operations Command, and Alex Jones has said that several of his staff members have worked at MacDill, but Olszewski also made her big media debut by appearing on Tucker and InfoWars the same day. David Weiss mirrored a video on BitChute about how insane asylums built in the 1800s are Tartarian architecture because they couldn't have been built using horse-and-buggy technology. [https://www.bitchute.com/video/JudNoQ9Y0PsS/] And he mirrored another video which first discussed the "fallen titan Montgo" and then claimed that stones are petrified organs of animals. [https://www.bitchute.com/video/lk3Z6o0LOiDq/] Weiss also mirrored a video about mud floods called "Weight Of The Flood Caused A World Wide Volcanic Ash Event". [https://www.bitchute.com/video/7DBsIRiZ0jVf/] And Weiss mirrored a video by the flat earther Jamie Lee (A Plane Truth), who said that in old buildings like churches, the domes were magnetrons which healed through magnetism, the spires were employed for Wi-Fi communication, and the fireplaces were the energy centers of the buildings. [https://www.bitchute.com/video/5rcT2DW8DGlZ/, time 15:25] And next in the same video, Jamie Lee also said that the Tartarian Empire was destroyed by an electromagnetic vibration frequency weapon which was tuned for life, and that 9/11 was done with an electromagnetic vibration frequency weapon which was tuned for steel molecules. After David Weiss's old website deepinsidetherabbithole.com had become inactive, it used to get redirected to Ole Dammegård's website lightonconspiracies.com. [http://mileswmathis.com/interview.pdf] In February 2020, Dammegård was interviewed by Jason Goodman about the theory that 5G causes COVID. [https://twitter.com/search?q=ole%20dammegard%20virus] Dammegård appeared several times as a guest on Jason Goodman's YouTube channel in early 2020. Dammegård and Jason Goodman did a livestream with Andrew Kaufman on May 11th 2020 UTC, and Goodman tweeted that it was "one of the best conversations I've heard about #covid_19 #pandemic". [https://twitter.com/LightOnConspira/status/1259854845646901248, https://twitter.com/csthetruth/status/1259898731052371970] Dammegård published a blog post about a video by Aajonus Vonderplanitz on April 1st UTC and a video of Andrew Kaufman's presentation livestreamed by James True on April 4th UTC. [https://lightonconspiracies.com/the-only-way-to-get-a-virus-is-to-be-injected-with-it/, https://lightonconspiracies.com/the-anatomy-of-the-covid-virus/] In his blog post about Kaufman's video, there's a link to an earlier version of the post with the same title dated March 31st, but the earlier post has now been deleted and it's not available at the Wayback Machine. But anyway, on March 31st I believe Kaufman hadn't appeared anywhere in alt media outside of flat earth channels and his own channel. Ole Dammegård has also done an interview about flat earth with Marty Leeds. [https://lightonconspiracies.com/tag/flat-earth/] In 2020 jeranism and David Weiss hosted a livestream where Jason Goodman debated whether the earth was flat with Rose777, but the debate was predictably structured so that Goodman appeared to lose it. [https://www.youtube.com/watch?v=krMEl0u174o] David Weiss introduced the video by saying: "So, um, I've been, you know, seeing Jason's videos for a long time, but then at the beginning of the protests, the lockdown, I caught one of Jason's streams where he was walking through Brooklyn and really standing up for New York, standing up for truth, and it blew me away. I immediately became a Patron, and I've watched almost every show he's done ever since. He does shows with Ole Dammegård a couple times a week or once a week on monday. And uh, he's really doing important work. So, um, there's different people that we like inviting on the show, people that slam flat earth, I love getting them on there because I got my fighting gloves on. You - I've only heard you go, 'flat earth, I don't know about', that's all I know about your views on flat earth. You could elaborate in a minute. But um, I want to talk to you about flat earth, but one thing is, I don't - I was like - I was hesitant going, do I want Jason focusing on flat earth, not that you're gonna drop what you do - um, because what you do is essentially important. You know, the truth seekers out there, there's Jason Goodmans, then there's Crow777s and Roses and Davids that do this over here, and then there's, you know, Crrow777, and all together I think we make a good truth soup. So I love your work, and I figured if you know the globe lie like we like we call it - you can see the globe lie - maybe your work will get even better if your feet are planted on familiar ground." [time 1:27] As of 2023, the URL deepinsidetherabbithole.com gets redirected to stoplookthink.com, which is a website that seems to mostly consist of links to BitChute videos by David Weiss and Spacebusters. The front page of the website features 16 embedded Bitchute videos about COVID, Sandy Hook, and 9/11, but none of the videos are about flat earth, so maybe website is supposed to appeal to people who are suspicious of flat earth. One of the videos is a copy of Sofia Smallstorm's film about Sandy Hook that is mirrored on David Weiss's BitChute channel. David Weiss, Sofia Smallstorm, and Ole Dammegård all used to be specialized in mass shootings and 9/11. Jason Goodman now does livestreams together with John Cullen, who used to be specialized in the Las Vegas shooting, and the oldest videos on Cullen's YouTube channel are about the Las Vegas shooting. Cullen has come up with a theory that the deaths attributed to COVID were caused by H7N9 avian influenza, which seems like disinformation similar to the no-virus theory, George Webb's story about Maatje Benassi, and Couey's clone theory. Cullen also speaks Dutch and he has posted a bunch of tweets in Dutch. [https://twitter.com/search?q=from%3AI_Am_JohnCullen%20lang%3Anl&f=live] It's interesting because Couey used to live in the Netherlands and his wife is Dutch, and Goodman previously did livestreams together with George Webb who said that he used to work with Dutch intelligence: "So, let me - I was talking about Mossad earlier. So, so, I didn't know that these people that were presenting themselves - little bit at a time - 'Oh, I'm just a diplomat. Oh, I'm just actually, uh, well, actually I had some intelligence background way back when. Oh, actually, um, I did a few operations. Oh, well, I might still do occasional stuff for blah blah blah. Oh, yeah, actually I am French intel.' That kinda procedure. And this happened to me with the Dutch. And now I'm just - I'm gonna let everybody know right now, I used to work with the Dutch. So it wasn't Russia. And I did drops." [https://www.pscp.tv/w/a_x8cDFEWUtYa0RwcWRwUWd8MXluS09qV3B3QlZ4UvjvMvixyqHi5E7VGH9t5zF4ulqSFK4NNYOqsMyKHhmr, time 10:45] George Webb wrote a book titled "Spray It In Dutch: If It Kills, The Erasmus Lab Will Make It A Spray", where he said that Erasmus Medical Center where JC worked was one of NATO's main bioweapon development labs. In September 2023 there were two shootings at Rotterdam where an Arab student at Erasmus Medical Center is supposed to have killed two people at a residential area and one person at EMC, but George Webb was the main person in alt media who was researching the shootings. When breakfast_dogs posted a high-quality thread about the laboratory origin of COVID, John Cullen posted a reply which said that COVID origins is a red herring, and he posted a video clip of his interview with the Jewish "counterbioterrorism expert" Tau Braun (who has been a speaker at a bunch of emergency management conferences, who says that COVID jabs are programmed to grow snake venom glands inside the human body and that graphene oxide acts as a carrier for snake venom in COVID jabs, and that Aryans are immune to COVID jabs because they are a race-specific bioweapon which was designed by the Fourth Reich to kill off nine tenths of humanity). [https://twitter.com/I_Am_JohnCullen/status/1749228439071244446] Couey is always also saying that COVID origins is a "red herring". One interview that Stew Peters did with David Weiss was titled "TRUTH About Flat Earth Theory: Biblical Firmament vs. Round Ball Earth Propaganda", and its description said: "This week on Stew Peters premium, we are joined by Dave Weiss to discuss NASA and Big Tech's lies surrounding the shape of the earth we all live on." [https://stewpeters.com/video/2022/11/truth-about-flat-earth-theory-biblical-firmament-vs-round-ball-earth-propaganda/] In one episode of the Stew Peters Show, the first guest was Emily Grace Rainey who they described as a "former Special Operations psyop officer", and the second guest was David Weiss. [https://www.stewpeters.com/video/2022/12/power-blackouts-sweep-nation-former-special-operations-psyop-officer-warns-of-incoming-war/] I don't know how long Stew Peters has been a flat earther, but by 2023 he was saying on Twitter that the earth is flat. [https://twitter.com/realstewpeters/status/1686187946141999105, https://twitter.com/realstewpeters/status/1695953001599349218, https://twitter.com/realstewpeters/status/1642979962318643204]

## Tom Barnett

Tom Barnett is an Australian alternative health practicioner and YouTuber. He is an advocate of eating raw meat like Aajonus Vonderplanitz, so I don't know if learned to question germ theory from Vonderplanitz. In 2016, Barnett posted a YouTube video about rethinking germs where he ate raw chicken in order to find out if salmonella and _E. coli_ really make you sick. [https://www.youtube.com/watch?v=SSuWC4HuiPE] Jeff Green is also an advocate of eating raw meats, he was also talking about germ theory before COVID, and he refers to Vonderplanitz on his website. [https://virusesarenotcontagious.com/blog-articles-by-jeff-green/] I don't know if Barnett discussed virology before COVID, but the oldest post on Barnett's blog is from April 5th 2020 UTC. [https://thebigvirushoax.com/blog/f/question-everything] On March 31st 2020 at 17:14 UTC, Max Igan mirrored a video on BitChute where Tom Barnett said that viruses are not contagious because they are solvents produced by the body. [https://www.bitchute.com/video/xhudT0Ssnt4/] When I searched Twitter for `"tom barnett" until:2020-4-2`, I found only two tweets which mentioned Barnett's video before Max Igan had mirrored it on BitChute. [https://twitter.com/search?q=%22tom+barnett%22+until%3A2020-4-2&f=live] Barnett's video was also mentioned in an article on David Icke's website dated April 1st. [https://davidicke.com/2020/04/01/deep-virus-rabbit-hole-question-everything/] Around April 6th UTC, Barnett posted a second part to his video which was mirrored by several flat earthers like DITRH, The Daily Plane, and Paul on the Plane. [https://www.bitchute.com/video/cutq9nqY4mWY/, https://www.thedailyplane.com/hes-back-tom-barnett-part-2/, https://www.youtube.com/watch?v=o9mYqj9FS5Q] Around March 30th UTC, The Daily Plane and Paul on the Plane both mirrored a video titled "Germ Theory vs Terrain Theory". [https://www.thedailyplane.com/germ-theory-vs-terrain-theory-mirror/] The Daily Plane mirrored a video by Kaufman around April 2nd UTC. [https://www.thedailyplane.com/special-report-humanity-is-not-a-virus-mirror/] On April 3rd UTC, Paul on the Plane mirrored a video of Kaufman's interview with HighImpactVlogs. [https://www.youtube.com/watch?v=Ur7TjqzcATI] One of the first channels on BitChute which mirrored Barnett's videos was the channel of the fed operation Goyim Defense League. [https://www.bitchute.com/search/?query=%22tom+barnett%22&kind=video&sort=old] In 2022, David Weiss did an interview about flat earth on the podcast of Rob Edwards. At the beginning of the podcast, Edwards promoted Barnett's Living Free Movement and George Wiseman's AquaCure products. During the interview, David Weiss said: "I feel honored. I was looking at your channel. You've had some legends on. You've had Benjamin Balderson, you had Amandha Vollmer, you had Crrow and Jason, you had Tom Barnett." [https://www.youtube.com/watch?v=xGr7xDRQzdw&t=7m4s] The description of the podcast episode says: "If you enjoyed this episode, do me a huge favour and check out this link: https://bit.ly/digwithin ". The link takes you to a website for George Wiseman's AquaCure products, where a huge block of text at the top of the website says: "Natural Medicine Practitioners Tom Cowan, Andrew Kaufman and Amandha Vollmer Are ALL Utilizing THIS MACHINE". The website features two videos of people who talk about how great AquaCure's products are, but the other person is Lindsey Scharmyn, who was one of the six flat earthers who were featured in James True's livestream of Andrew Kaufman's presentation. Tom Barnett has done several interviews with Cal Washington, who is specialized in legal topics and sovereign citizenship. [https://www.google.com/search?q=%22tom+barnett%22+%22cal+washington%22] In an interview with HighImpactVlogs around April 3rd 2020 UTC, Kaufman was asked what legal strategy could be used to resist mandatory vaccines, and Kaufman replied: "I learned about this gentleman named Cal Washington. And he is an individual who has through his own experience and through his own learning - has studied how the law is practiced and enforced in our country. And he even actually had to spend some time behind bars to figure this out. And his only crime was not having insurance for his car. So he's a very moral person. He would definitely not cause harm to any other individual. But through this experience, he has gained a level of knowledge that is pretty incredible. And he joined up with other people in this area, and they formed this group called InPower that I would definitely - you know, refer your audience to check out. And what they did is they came up with this legal strategy which is known as - it's called a notice of liability." [https://www.youtube.com/watch?v=Ur7TjqzcATI&t=1h12m44s] A few minutes later, Kaufman said: "So Cal and I are actually going to both appear together on Richie from Boston's YouTube channel tomorrow evening at 5:30 Eastern, and we're gonna lay out this strategy in more detail than I'm describing it now. And you know he's really the main legal expert." I don't know if the interview was canceled because I didn't find it anywhere. But nevertheless it's interesting that Kaufman was already connected to Cal Washington in early April 2020. Barnett has done several livestreams with Owen Benjamin, who also used to do livestreams with James True before they had a falling out. Barnett has also been interviewed by the flat earthers Amandha Vollmer, Crrow777, and Rogue Ways. Alfa Vedic's AlfaCast podcast has had 168 episodes so far, which have included many repeat guests and many episodes without a guest. But their guests have still included Tom Barnett, Owen Benjamin, Tom Cowan, David Icke, Max Igan, Andrew Kaufman, Marty Leeds, Sofia Smallstorm, James True, Amandha Vollmer, Cal Washington, David Weiss, George Wiseman, and Andreas Xirtus. [https://podcast.app/alfacast-p801122/] In 2023 Tom Barnett posted a video about flat earth where he said: "Do I know that it's a 100% flat and that's how it really is? No, I don't. I just know observably it is flat. And then, it's a spinning ball? Aww, man, like I said, I used to say I'll give you one nut and one kidney - because technically you can function one one of those - but I'm so sure I'll give you both nuts, both kidneys, and this lovely Music Man guitar should you be able to prove to me it's a spinning ball." [https://tombarnett.tv/2023/03/03/member-hang-3-grief-finding-a-good-wife-flat-earth-and-more/, 47:41]

## Amandha Vollmer

In 2020, I found 12 YouTube channels which had reposted the "Hippocratic Hypocrisy" film, out of which 9 were flat earth channels, one was Kaufman's channel, and one was Amandha Vollmer's channel YumNaturals Emporium. In April 2020, Amandha Vollmer did a presentation about Lanka's theory at EVENT 202, whose logo featured a disc earth and whose main organizer was the British mulatto flat earther Allegedly Dave. Another speaker at EVENT 202 was the ex-military flat earther Shelley Lewis. In July 2020, Vollmer was interviewed by the flat earther Jeranism, who has also done multiple interviews with Sofia Smallstorm. [https://www.youtube.com/watch?v=pdO9UArGR24] In 2021 when Amandha Vollmer was interviewed by Patrick Timpone, Timpone first discussed flat earth, and then Vollmer said: "(57:35) I think the hardest part is getting over the lies, and the fake science and the fake gurus, and all that stuff. But just get out your protractor, and you'll figure it out. The geometry will never work unless it's completely flat." [https://oneradionetwork.com/all-shows/amandha-vollmer-the-culling-has-begun-and-its-coming-with-a-twist-november-11-2021/] Timpone has also done interviews about germ theory with Sofia Smallstorm and Steve Falconer. [https://oneradionetwork.com/all-shows/sofia-smallstorm-some-astonishing-facts-about-the-polio-virus-vaccine-and-more-april-15-2020/, https://oneradionetwork.com/all-shows/steve-falconer-coronafraud-mind-control-germ-theory-its-a-brave-new-world-august-24-2022/] In 2023, Amandha Vollmer did an hour-long presentation about flat earth hosted by Kelly Brogan. [https://yummy.doctor/video-list/corrected-cosmology-with-amandha-vollmer-and-kelly-brogan-of-the-sovereignty-series/] Vollmer has also posted links to videos about Tartaria and mud floods on Telegram. [https://t.me/s/amandhavollmer?q=tartaria] And in one Telegram post she wrote: "Tesla, just another actor to hide the truth of the aether and the Antiquetech, all the Cathode Cathedrals, the Spires, the Water Batteries and the WORLD WIDE free energy we had before the Mud Flood. Another False Hero put to shame." [https://t.me/amandhavollmer/1824] Vollmer mirrored several videos by Stefan Lanka at YouTube starting around January 30th 2020. [https://yummy.doctor/video-list/hiv-does-not-exist-dr-stefan-lanka-explains-the-hiv-lie/, https://yummy.doctor/video-list/dr-stefan-lanka-why-hiv-has-never-been-isolated/] In November 2019, the flat earth channel "Flat Water FE" posted a video featuring Lanka called "Do Viruses Exist?", and the video was also mirrored by the flat earth channel "Francis Judge II", even though both videos have now been deleted. [http://web.archive.org/web/20200327141237/https://www.youtube.com/watch?v=t0uemkf9c88] (Because YouTube has deleted so many videos which question the official narrative about COVID, now if you go through old videos by flat earth channels you can no longer see how flat earthers started posting videos about the no-virus theory around the same time in early 2020, or in some cases even in late 2019. And many flat earth channels that posted videos about COVID have been deleted entirely, so now the flat earthers who didn't post about COVID are overrepresented among the surviving flat earth channels.)

## Omega Institute at Rhinebeck

The Omega Institute for Holistic Studies is located about 100 km north of Manhattan in Rhinebeck, New York. James True attended a retreat at Rhinebeck in summer 2019 and summer 2020, where met with Andrew Kaufman in 2019 and with Amandha Vollmer and Benjamin Balderson in 2020. The Omega Institute is affiliated with the Jewish guru Ram Dass, and their facilities were built on the former grounds of a Yiddish camp: [https://en.wikipedia.org/wiki/Omega_Institute_for_Holistic_Studies] > Omega Institute for Holistic Studies is a non-profit educational retreat center located in Rhinebeck, New York. Founded in 1977 by Elizabeth Lesser and Stephan Rechtschaffen, inspired by Sufi mystic, Pir Vilayat Inayat Khan and his ecumenical spirituality, today it offers classes to over 25,000 people a year, at the 190-acre (0.77 km) campus.[1][2][3][4] > [...] > In 1977, co-founders Stephan Rechtschaffen, author of _Timeshifting_, and Elizabeth Lesser, author of _The Seeker's Guide_ and New York Times best-selling _Broken Open_, say they were inspired to create the Omega Institute by scholar and Eastern meditation teacher, Pir Vilayat Inayat Khan.[8][9][10][11] The name "Omega" came from the teachings of Pierre Teilhard de Chardin, a 20th-century French philosopher and Jesuit priest who used the term "Omega Point" to describe the peak of unity and integration toward which all life is evolving. > [...] > In 1982, Omega expanded from rented facilities in New York and Vermont to its current location on the former grounds of Camp Boiberik, a Yiddish camp, in Rhinebeck, New York.[13] > [...] > Its buildings also include the Ram Dass Library, named for author Ram Dass who "has been a trusted guide to Omega". In honor of Dass' life's work, the organization commissioned the library, which is designed in an eight petal lotus blossom shape to represent Ram Dass' service to public health, advancing social justice, and supporting spiritual development throughout the world.[9][12] The chair of the Omega Institute's board of directors is Manuela Roosevelt, who is married to FDR's grandson David B. Roosevelt. [https://www.eomega.org/about/people/board-of-directors] She is also the chair of the "Eleanor Roosevelt Val-Kill Partnership" whose founding chairs were Hillary Clinton and Claudine Bacher. [https://www.valkill.org/who-we-are] Bacher's mother was a Belgian Jew and her father was a Romanian Jew, and she wrote that her grandfather was a "distinguished leader of the Antwerp Diamond dealers" (and Antwerp is the center of the world's diamond trade). [https://www.thecommongoodus.org/my-american-story-posts/my-american-story-claudine-bacher] The president of the Omega Institute is Carla Goldstein, who is a member of several feminist organizations and who previously worked for Planned Parenthood. [https://www.eomega.org/workshops/teachers/carla-goldstein] Joel van der Reijden wrote: [https://isgp-studies.com/psychedelics-and-elites] > As for the Rockefeller ties of Weil's old "nemesis", Ram Dass, he and Buddhist meditation guru Master Thich Nhat Hanh were involved in setting up the Center for Contemplative Mind in Society in 1991, together with the then president and CEO of the Nathan Cummings Foundation. Soon a first conference was organized at the Rockefeller's Pocantino retreat, with Steven Rockefeller writing one of the white papers. By 1995, Ram Dass and Thich Nhat Hanh both were involved in the super-elite State of the World Forum, organized by the Rockefellers, Ted Turner, Maurice Strong and other globalist new age-oriented leaders. Today Ram Dass still sits on the "council of sages" of the California Institute of Integral Studies (CIIS), its largest historical donor having been Laurance Rockefeller. Decades before all these ties, Ram Dass, of course, was involved in the Laurance Rockefeller-backed Esalen Institute. Ram Dass mentioned both Laurance Rockefeller and the Omega Institute in his autobiography: [https://books.google.com/books?id=v9HoDwAAQBAJ&pg=PT404] > My dear friend Joan Halifax brought Laurance Rockefeller to visit. He and I had met in the early nineties, and I'd stopped in a couple of times at his Park Avenue apartment in New York. > [...] > When Laurance heard about my stroke, he contributed to the fund for my rehabilitation, my endless stream of therapists and handicap adaptations. It was wonderful to see him. In the past, we'd smoked pot together and played verbal consciousness games. > [...] > After about six months of rehab, I started traveling to speaking engagements. I gave workshops at Omega Institute in upstate New York and Breitenbush Hot Springs in Oregon, old stomping grounds where I had held retreats for years. When I googled for `site:eomega.org rockefeller`, I found that one of the teachers listed on the website of the Omega Institute "launched the Transformational Change Leadership Initiative with the Rockefeller Foundation focused on women leaders in government and civil society." [https://www.eomega.org/workshops/teachers/pat-mitchell] And another teacher was "an artist-in-residence at the Rockefeller Foundation Study and Conference Center in Bellagio, Italy". https://www.eomega.org/workshops/teachers/alejandro-fogel] And another teacher "toured her original musical _Shine_ to select cities that are a part of the Rockefeller Foundation 100 Resilient Cities Initiative to engage youth voices in resilience planning". [https://www.eomega.org/workshops/teachers/beth-osnes] And another teacher has "a residency from the Rockefeller Foundation's Bellagio Centre". [https://www.eomega.org/workshops/teachers/courtney-e-martin] However when I googled for `site:eomega.org/workshops/teachers`, there were a total of over 2,000 results, so I guess it's not that unusual that a few of the teachers are affiliated with the Rockefeller Foundation, especially since the Omega Institute is located in New York. Russell Targ has also taught remote viewing courses at the Omega Institute. [https://www.eomega.org/workshops/teachers/russell-targ] And I think the Omega Institute might list someone as a "teacher" on their website if they have just given a single talk at the institute, because even Bill Clinton is listed as one of the teachers on the website (and the URL for Clinton's page features the directories `/workshops/teachers/` like the URLs of all other "teachers", even though I don't think all of the teachers taught a workshop). [https://www.eomega.org/workshops/teachers/president-bill-clinton] Someone who visited the Omega Institute in 2018 said that in the faculty dining room, there was a wall which had portraits of famous people who had visited the Omega Institute, and it had a portrait of John of God next to Gloria Steinem and Eckhart Tolle. [http://matthewremski.com/wordpress/why-are-portraits-of-john-of-god-and-gloria-steinem-beside-each-other-at-omega-institute/] In 2017, the Omega Institute issued a press release which said: "We are profoundly disheartened by the serious allegations of sexual misconduct by João Teixeira de Faria (John of God) at his facility in Brazil. As a lifelong learning organization committed to exploring different modalities of holistic healing, Omega offered an opportunity to participate in John of God's programs at our Rhinebeck, New York, campus a number of times beginning in 2007 and ending in 2017." [https://www.eomega.org/about-omega/press-center/statement-from-omega-regarding-john-of-god-allegations] It's interesting that the Omega Institute was named after a concept developed by a Jesuit priest, because John of God says that he built his Casa compound in Brazil at the instruction of St. Ignatius of Loyola. [https://www.johnofgod-healing.com/about-the-casa/] John Of God says that there are 33 entities who he is able to channel and who also reside at his Casa compound. They include St. Ignatius and famous historical doctors, but they also include mythical figures who are known as Masters of Ancient Wisdom in Theosophy, like Kuthumi, Morya, and Serapis Bey. [http://web.archive.org/web/20190212163432/www.johnofgodlove.com/entities/, https://books.google.com/books?id=3GVuDQAAQBAJ&pg=PA185] Supposedly when Henry Steel Olcott's own master Morya was unavailable, Olcott was given occult training by Serapis Bey. [https://en.wikipedia.org/wiki/Serapis_Bey] A volunteer at the Casa said: "We pray the Lord's Prayer because Dom Inacio, the patron of the Casa, was a Jesuit, and we pray the Hail Mary because he was devoted to Mother Mary. When I told The Entity that foreigners did not want to say the prayers, he replied: 'But my daughter, the master of all masters is Jesus! Women must be worshipped, especially the mother of the Master. The entities of the Casa are Jesuit!'" [https://books.google.com/books?id=3GVuDQAAQBAJ&pg=PA152] The website of the Omega Institute says that one of the three cofounders of the institute was the Sufi mystic Pir Vilayat Inayat Khan. [https://www.eomega.org/about/overview/history] He was born in London, and his sister Noor worked for British intelligence according to a book titled _ Spy Princess: The Life of Noor Inayat Khan_. The book also mentions that Noor was engaged to a Turkish Jew named Goldberg. [https://books.google.com/books?id=BRw7AwAAQBAJ&pg=PA42] An article about Beorse Shamcher Bryn says that "He was instrumental in encouraging Pir Vilayat Inayat Khan to take his role as head of the Sufi Order as well as encouraging the connection between Murshid SAM and Pir Vilayat that produced a flowering of universal Sufi activity in North America in the late 1960s and 1970s." [https://sufipedia.org/en/personenregister/noorwegen/] Before Bryn became involved with Sufism, he was a member of the Theosophical Society and the Order of the Star in the East, which was established by Theosophists in 1911 in order to prepare the world for the arrival of the World Teacher Maitreya. [http://www.shamcher.org] The Omega Institute is part of the International Holistic Centers Gathering, which was founded by Ralph White who wrote that the institutions initially involved with the Centers Gathering "included the newly established New York Open Center from Manhattan, Esalen Institute from Big Sur, California, Omega Institute from upstate New York, and the Boston/Cambridge center known as Interface". [https://www.centersnetwork.org/about-hcn-and-centers-gathering/centers-gathering-a-history/] The website of the Centers Gathering said that Ralph White was "instrumental in launching Omega Institute for Holistic Studies in Rhinebeck in 1982, now a kind of East Coast Esalen, where he was program director", and that White "has since been a seminal figure in the emerging global network of holistic centers which can be seen as part of an esoteric expression of Findhorns concept of the Network of Light." [https://www.centersnetwork.org/2016/08/31/creating-centers-of-consciousness/] Both the Centers Gathering and Findhorn Foundation are possibly involved with child sex rings, but I haven't yet investigated it further. [https://peakd.com/news/@whitedeer9217/ra-anon-esalen-ring-pedophilia-tied-to-hai-global-harbin, https://peakd.com/pedogate/@whitedeer9217/centers-gathering-ring-pt-2] When Ralph White was asked who he would have dinner with if he could choose any living or dead person, he answered: "The great Austrian philosopher, educator and spiritual scientist, Rudolf Steiner. ... He was possessed of an unrivaled grasp of the worlds esoteric traditions, and conducted stunning and deeply moving research into higher worlds, karma and reincarnation, and the true nature and destiny of humanity." [https://matadornetwork.com/bnt/the-seeker-chronicles-ralph-white/] Steiner is also one of Tom Cowan's top two gurus along with Weston Price. The Omega Institute started out as basically the east coast version of the Esalen Institute, but Jan Irvin has written about how the Esalen Institute had a key role in launching the MKULTRA psychedelic counterculture. [https://logosmedia.com/2012/08/how-darwin-huxley-and-the-esalen-institute-launched-the-2012-and-psychedelic-revolutions-and-began-one-of-the-largest-mind-control-operations-in-history/]

## Tom Cowan

Like many other leading no-virusers, Cowan also has a background in occultism, because he set up an anthroposophical medical practice in the 80s and he served as the vice president of the "Physicians Association for Anthroposophical Medicine". [https://www.westonaprice.org/about-us/board-of-directors/] In one of his books, Cowan wrote that in 1983 when he attended an anthroposophical conference, he was so impressed with a speech he heard that he decided that he wanted to one day be able to speak from the same "place of knowing" as the speaker, and he wrote that "I had a sense that learning anthroposophy would provide me with the path". [https://books.google.com/books?id=rgJODQAAQBAJ&pg=PA41] Then he wrote that he spent three months learning "anthroposophical medicine from three of the country's best practitioners, who had agreed to take me on as an apprentice." He wrote that when he was taught by one of his mentors in New York, his family was provided housing in a Steiner-inspired village for developmentally disabled adults. Cowan wrote that he one of his teachers was Dr. Otto Wolff, who Cowan described as "the main person who came from Europe to start anthroposophical medicine in the United States", and who taught Cowan "how to memorize the anthroposophical and homeopathic pharmacopeia, sing in a choir, and learn the metals, the constellations, plants, gardening, and the movement of water." In a speech that Rudolf Steiner gave in 1915, he said that in order to achieve a spiritual equilibrium, it is necessary for people to embrace the principles of Lucifer and Ahriman, and he said that "we can detect a Luciferic remnant in the east, which, I would say, is a wise guiding force left behind for the evolution of mankind in general". [https://rsarchive.org/Lectures/ChrLuc_index.html] Steiner also said that the current epoch was the Fifth Post-Atlantean Epoch and that "The man of the Fifth Post-Atlantean Epoch, who confronts Ahriman-Mephistopheles, must take Lucifer into himself." [https://rsarchive.org/Lectures/BalWorld/19141120p01.html] Sounds just like James True. I also found that on December 8th 2019, Tom Cowan published a blog post titled "A Big Change in EMFs Preceded Each Pandemic" where he wrote: "I recently finished reading a very sobering book on the history of electricity and its effects on life called 'The Invisible Rainbow' by Arthur Firstenberg. During the coming weeks and months, I will share revelations I gained from reading this masterpiece, as in many ways it supports and extends the primary thesis of my last three books." [https://drtomcowan.com/blogs/blog?page=5, https://drtomcowan.com/blogs/blog/a-big-change-in-emfs-preceded-each-pandemic] So it might be that Cowan was already being coached on the no-virus narrative in 2019 or he was told to read the book in advance. In his blog post he said that he would be "sharing revelations" from the book over the coming months, which seems fairly prescient considering that the book played a key role in Cowan's early presentations about COVID, and that in early 2020 the book was also discussed by Robert David Steele, Sacha Stone, Andrew Kaufman, and Sofia Smallstorm. Tom Cowan's first viral video about COVID consisted of a short 11-minute talk he gave on March 12th 2020 local time at the "Health And Human Rights Summit" in Arizona. [https://www.bitchute.com/video/XV4nqpXf4s71/] There's a copy of the video at BitChute where the description says "Camera, sound and editing by Joshua Coleman." [https://www.bitchute.com/video/XV4nqpXf4s71/] In 2020, Joshua Coleman organized an anti-vax event in California together with Jonathan Lockwood who is a Scientologist. [https://t.me/s/co_appleseed, https://twitter.com/JNTHN_LCKWD/status/1576004158246699008] Lockwood is also the excecutive director of Conscience Coalition, which is an anti-vax organization that was cofounded in 2019 by Renee Bessone and her husband Greg Mitchell. [https://consciencecoalition.com/press/] Mitchell was called the primary lobbyist for the Church of Scientology in DC. [https://www.businessinsider.com/church-of-scientology-washington-lobbyist-2015-4] Bessone has reached OT level VIII which is the highest auditing level in Scientology. [https://www.truthaboutscientology.com/stats/by-name/r/renee-bessone.html] Mitchell's lobbying firm has also represented Soros's Open Society Policy Center, and the Mitchell Firm is listed as having received 80,000 USD from Open Society Policy Center in 2006, 80,000 USD in 2007, 55,000 USD in 2008, and 70,000 USD in 2013. [https://www.facebook.com/notes/4567792496626364/, https://www.opensecrets.org/Lobby/firmsum.php?id=F223880&year=2013] The domain name of Conscience Coalition was registered by Timothy Akey, who is a former pharmaceutical representative. [https://www.facebook.com/notes/4567792496626364/] Tom Cowan's knowledge of genetics is so vast that when the authors of a scientific paper wrote that they "designed 37 pairs of nested PCRs spanning the genome on the basis of the coronavirus reference sequence", Cowan thought that it meant that "rather than having isolated the virus and sequencing the genome from end to end, they found 37 base pairs from unpurified samples using PCR probes. This means they actually looked at 37 out of the approximately 30,000 of the base pairs that are claimed to be the genome of the intact virus. They then took these 37 segments and put them into a computer program, which filled in the rest of the base pairs." [http://web.archive.org/web/20201015211840/https://drtomcowan.com/only-poisoned-monkey-kidney-cells-grew-the-virus/] Cowan later edited his article to remove the text about the 37 base pairs. But in an article where Jon Rappoport commented on Cowan's article, he quoted the same text about the 37 base pairs I quoted above but he didn't point out any error within the text, which is a good indication of how much he knows about genetics. [https://blog.nomorefakenews.com/2020/10/19/dr-tom-cowan-explores-the-covid-virus-invented-out-of-sheer-nonsense/] Rappoport is a Kohanic rabbinic surname. [https://en.wikipedia.org/wiki/Rappaport_family] In an interview that Tom Cowan did with Steve Falconer, he said that he grew up in a Jewish ghetto and he was a member of a Jewish country club: "I grew up in a what I would call a Jewish ghetto, but you know Jewish ghettos are a little bit more high - you know, like it was not a, uh, I mean, I've lived in a brick shack, basically when I grew up. But, but, I - my parents had a lot of friends, and we were in a kind of a group - and I'd say 10 of these friends who I grew up with. [...] Golf was everything to them, and I was the best golfer in the group. In fact they lived to win the club championship of this Jewish country club, and they wouldn't let me play until I was 15, right, because that's you know, that's like - and I was 15 and I came in, and I won easily, like no problem." [https://www.youtube.com/watch?v=PNLOqG783mU&t=21m3s] A newspaper article about Anglo-Jewish surnames from the year 1888 said that the name Cowan is an Anglo-Jewish form of the name Cohen: "Among simpler changes are Cowan - Cohen, Lewin - Levi, Victor - Avigdor, Archer - Asher, Jessop - Joseph, and Soman and Sowman - Solomon." [https://cdnc.ucr.edu/?a=d&d=MU18881021.2.25]

## Similarities between early no-virus presentations

In presentations they did in March 2020, Andrew Kaufman, Tom Cowan, Sofia Smallstorm, and Steve Falconer all presented a suspiciously similar version of the no-virus narrative. For example they all said that COVID may have been caused by 5G, and they all said that viruses are produced by the human body in response to stress (which later seems to have become a heresy among the no-virus crowd). On March 23rd 2020 local time, Sofia Smallstorm appeared as a guest in an episode of the jeranismRAW flat earth podcast, where the other two guests were the flat earthers David Weiss and Jason Lindgren. Smallstorm said: "(9:51) Viruses actually are healing agents, because they are a little like nanobatteries. They're smaller than cells, they're protein-containing and crystalline material - they're DNA-ordered, they're coded for. And it means that when there is a lot of cellular injury, whether it's from disease or whatever, viruses are deployed, they are created and deployed. [...] (36:46) Flu is not a virally caused disease. Arthur Firstenberg's book _The Invisible Rainbow_ will tell you that flu is primarily generated by electricity in the homes, which is actually quite believable. [...] (51:45) So one thing that we haven't talked about here is the 5G angle in Wuhan." [https://www.youtube.com/watch?v=cstuEFrcjTI] Tom Cowan's first viral video about COVID consisted of a short 11-minute talk he gave on March 12th 2020 local time at the "Health And Human Rights Summit" in Arizona. [https://www.bitchute.com/video/XV4nqpXf4s71/] During the talk, Cowan said: "(2:26) When the cells get poisoned, they try to purify themselves by excreting debris, which we call viruses. If you go to the current theory of viruses called exosomes and the latest head of the NIH giving you a talk on the complexity of viruses, you will see this is perfectly in line with the current thinking on what a virus really is. [...] (5:37) They even did it with horses who apparently got the Spanish flu, and they put bags over their head, and the horses sneezed in the bag, and they put the bag over the next horse, and not one horse got sick. You can read about this in a book called _The Invisible Rainbow_ by Arthur Firstenberg, who chronicles all the steps in the electrification of the earth and how within six months there was a new flu pandemic all over the world. [...] (7:50) Anybody want to make one guess as to where the first completely blanketed 5G city in the world was?" [https://www.bitchute.com/video/XV4nqpXf4s71/] In an interview that Andrew Kaufman did with James True on March 24th 2020 UTC, he said: "I want to just point out a couple of studies that may also be somewhat reassuring, and I found these in the book _The Invisible Rainbow_ which I encourage you to check out. And it talks about the relationship between electricity and pandemics and disease." [https://www.youtube.com/watch?v=pdCZkJLc6ho&t=1h36m34s] During the same interview, James True said that there was a rollout of 5G in Wuhan and Italy, which Kaufman discussed himself in his other presentations. In a presentation on March 30th UTC, Kaufman said: "So what is it that causes us to make more of these exosomes and throw them out into our circulation? So it turns out that almost every type of insult to the body would actually cause this prod this process to occur, so toxic substances, and I found several papers looking at this - some of them looked at environmental toxins such as heavy metals like arsenic and organic chemical toxins - also found evidence about bacterial toxins, and I have a slide that I'll show you in a minute so there's clearly has a role in communication or possibly removal of toxic substances that damage our cells." [https://www.youtube.com/watch?v=KGGd7-vvd9Y?t=25m1s] On March 4th 2020 which as far as I know was before Kaufman or Cowan had started talking about germ theory, a video titled "Important Information on Coronavirus 5G Kung Flu" was published by Steve Falconer. [https://www.bitchute.com/video/mWcUoESRO0c5/] In the video Falconer said that 5G causes COVID, and the video also included a long segment of a radio show from 2009 where Aajonus Vonderplanitz talked about how viruses are "solvents" or "soaps" or "enzymes to fractionate tissue for waste elimination". [http://whale.to/a/aajonus-interview-apr-2009.pdf] I don't remember if Falconer talked about the _Invisible Rainbow_ book though. During the talk on March 30th, Kaufman actually credited Stefan Lanka and Tom Cowan as inspirations for his theory. But I didn't see anywhere in March 2020 that Smallstorm credited Kaufman, Cowan, or Falconer, or that Cowan credited Smallstorm, Kaufman, or Falconer, even though later in an interview in April 2020, Cowan said that a webinar by Kaufman was the source of some of his information. [https://drtomcowan.com/blogs/blog/what-s-in-your-water-part-1] In an interview with Robert David Steele that was published on April 1st 2020 UTC, Sacha Stone said that "a virus is an excretion from living cells that happens as a detoxification phenomenon", and he talked about the _Invisible Rainbow_ book and he said that COVID was caused by 5G. [https://www.bitchute.com/video/m4Qx_7FDunE/] And then Robert David Steele also said that he had a 17-page summary of the book on his website.

## EVENT 202

EVENT 202 was a virtual conference that was held on April 30th 2020. Even though the main theme of EVENT 202 was COVID, several of the speakers at EVENT 202 were anti-5G activists or alternative health advocates who barely mentioned COVID in their presentation. The logo of EVENT 202 featured a disc earth surrounded by the Antarctic ice wall. The main organizer of EVENT 202 is supposed to have been the British mulatto flat earther Dave Murphy, who is also known as Allegedly Dave, even though it could be that he only served as the figurehead of EVENT 202. One of the speakers at EVENT 202 was the ex-military flat earther Shelley Lewis, who made a flat earth film together with the ex-military flat earther Joshua Michael Gennari. On March 20th 2020 UTC David Weiss mirrored a video where Allegedly Dave said: "Everyone has a coronavirus and every other virus and bacteria you can possibly 'catch'. Because the body manufactures viruses and bacteria to get rid of toxicity and dead and dying tissue. Viruses do not cause disease. They are a consequence of the body dealing with disease, or the toxicity." [https://www.bitchute.com/video/1sq1fElcea0n/, time 2:15] Another speaker at EVENT 202 was Amandha Vollmer, whose presentation focused on Stefan Lanka's theory. Andrew Kaufman was earlier announced as one of the speakers for EVENT 202, but his appearance seems to have been canceled, and his page on the website of EVENT 202 was later removed. [https://twitter.com/EliTheWatchman/status/1254952618260140032, http://web.archive.org/web/20200501055658/https://event202.org/speakers/andy-kaufman/] Apart from Amandha Vollmer and Allegedly Dave, the other speakers at EVENT 202 were the following: - Ron Angell: he spoke about 5G, AI, and 9/11. He is also a member of Architects and Engineers for 9/11 Truth, which was founded by Richard Gage. Gage has done an interview with Andrew Kaufman and his website is sponsored by Kaufman's nutritional supplement products. [https://richardgage911.substack.com/p/dr-andrew-kaufman-no-proof-of-covid19, https://richardgage911.org/fulvic-mineral-supplement-with-andrew-kaufman-md/] Do all of these veterans of the controlled opposition really get fooled by Kaufman, or are they following a script that they're getting from some central location? - David A Barstis: his bio on the old website of EVENT 202 says: "He actively investigated the Sandy Hook capstone incident, and documented footage can be found at wearechangect/Wolfgang Halbig at YouTube. David is an associate in law enforcement and an advocate of freedom with a breadth of first hand experience in common law and the legal system and their courts." http://web.archive.org/web/20200501101644/https://event202.org/speakers/david-alan-barstis/] So he's yet another Sandy Hook hoaxer who is associated with law enforcement, just like Halbig. Halbig's famous 16 questions about Sandy Hook were debunked by C. W. Wade and Keith Johnson on Deanna Spingola's radio show. [https://spingolaspeaks.net/2014/12/14/c-w-wade-keith-johnson/] - Derek Broze: in his presentation at EVENT 202, he introduced himself by saying that he has made an anti-5G documentary and a documentary about pedophile networks, but his presentation focused on issues like how people can free themselves from the system and how people can take control of their health. - Jennifer Bruce: her profile on the website of EVENT 202 says that she is a quality consultant for the pharmaceutical industry and that she has been investigating the dangers of fast-tracked vaccine products, but her profile also says that she is trained in "rebirthing and divine breath", "shamanic journey-work", and "advanced Gestalt therapy leadership". [http://web.archive.org/web/20200501094401/https://event202.org/speakers/jennifer-bruce/] - Yasmeen Dahdah: she's some lady from Jordan. [http://web.archive.org/web/20200501114240/https://event202.org/speakers/yasmeen-dahdah/] When I searched for her name in double quotes on Twitter, there were only two results which were both about EVENT 202. - Shai Danon: he is an Israeli alternative health practicioner and an anti-5G activist. He was also a guest on Celeste Solum's YouTube channel. - Mark Devlin: he is a British conspiracy theorist whose YouTube channel was deleted and who now has about 6,000 subscribers on BitChute. He has appeared as a guest on the podcasts of Andrew Kaufman, Sofia Smallstorm, and Crrow777. Mark Devlin has said that he believes in flat earth. [https://www.youtube.com/watch?v=Zds1TMpvBOg, https://www.youtube.com/watch?v=R_LeoXQE3mQ] He was also a speaker at Flatoberfest 2023. [https://www.youtube.com/watch?v=yYjk8JO5gN4] And he was a speaker at a screening for a movie about Crrow777 that was done by Jason Lindgren. [https://mobile.twitter.com/djmarkdevlin/status/1186282750279651333] In April 2020 David Weiss mirrored a video by Mark Devlin where Devlin said that the coronavirus does not exist. [https://www.bitchute.com/video/DwCXVW6RqQjV/] Mark Devlin's blog and podcast is published on a website called One Great Work Network, whose logo features a pyramid with an all-seeing eye (and the profile pictures of two other people on the network feature a Star of David, one features the Tree of Life diagram, one features an Eye of Horus). [https://onegreatworknetwork.com/creators] - Matt Landman: he made a film about chemtrails, he's an anti-5G activist, and he launched an EMF-protecting clothing brand. - Shelley Lewis: her bio on the website of EVENT 202 says that she's a passionate truther and a licensed holistic health practicioner, that she holds a bachelor's degree from the United States Military Academy at West Point, that she served in the military for 5 years, and that she was the director and producer of the film "The Plane Truth: Behind What Curve?". [http://web.archive.org/web/20200501123842/https://event202.org/speakers/shelley-lewis/] Her film was about flat earth, and the "co-director" and "co-producer" of her film was the flat earther Joshua Michael Gennari who says that he served in the military for 12 years. [https://www.facebook.com/donate/344911212806730/, https://www.imdb.com/name/nm3926980/] Joshua Michael Gennari's YouTube channel features 8 channels he has added as recommended channels, which include Jeranism and Israeli News Live, who both did interviews with Sofia Smallstorm in early 2020 about how viruses are not real. [https://www.youtube.com/channel/UC3kzZNP9qgMFbM7wm9skWNQ/videos] - Cyrus Parsa: he is supposedly an AI expert who says that the CCP is going to enslave humanity through AI, and he has also focused on the topics of COVID and 5G. The oldest tweet I found which mentioned Parsa was made on October 29th 2019 UTC by an account called "Informal Warfare" whose profile picture is a drawing of Alex Jones, and the second oldest tweet I found was a link to an interview that Parsa did with Owen Shroyer on October 29th 2019 UTC. [https://twitter.com/search?q=until%3A2019-12-30+%22cyrus+parsa%22&f=live] In December 2019, Parsa filed a lawsuit against "Google L.L.C, Facebook inc, DeepMind Inc, Alphabet Inc, Neuralink Inc, Tesla Inc, Larry Page, Sergey Brin, Sundar Pichai, Mark Zuckerberg, Elon Musk, CISON PR NewsWire & John Doe's 1-29" for reasons such as "MISUSE OF ARTIFICIAL INTELLIGENCE, CYBERNETICS, ROBOTICS, BIOMETRICS, BIOENGINEERING, 5G AND QUANTUM COMPUTING TECNNOLOGY", and for transfering AI technology to China, and for violation of several genocide conventions because of China's treatment of Uyghurs, Tibetans, Christians, and Falun Gong. [https://digitalcommons.law.scu.edu/cgi/viewcontent.cgi?article=3104&context=historical] One of the oldest tweets I found which mentioned Parsa was posted by an account named "Uyghurtrailblazer" which tweeted: "A historic day for the Uyghurs and other victims of China. Mr. Cyrus Parsa filed a suit against Google, FB and a few others in California. Spread the news. I am calling on the Uyghurs and other freedom lovers to back Mr. Parsa!!!" [https://twitter.com/Trailbl16797622/status/1208942910454013953] To learn why the genocide of the Uyghurs is a hoax, you can read articles tagged with Uyghurs at _The Grayzone_. [https://thegrayzone.com/tag/uyghurs/] - Kate Shemirani: she is a former nurse who is now one of the most famous anti-vaxxers in Britain, and who is also known as an anti-5G activist. - Celeste Solum: she claims that she's a former employee of FEMA and that she is a Jew who converted to Christianity. As proof that she used to work for FEMA, she showed her certificate for FEMA's "Professional Development Emergency Management Series" in a YouTube video which has now been deleted, but her bio on her website also says: "Celeste has worked as a contractor for Homeland Security and FEMA. Her training and activations include the infamous day of 911, flood and earthquake operations, mass casualty exercises, and numerous other operations. Celeste is FEMA certified and has completed the Professional Development Emergency Management Series." [https://shepherdsheart.life/blogs/on-the-farm/bio] However the Professional Development Emergency Management Series by FEMA is series of fairly basic-level independent study courses which seems like it might be completed by someone who doesn't work full-time for FEMA or by someone who works for some other government agency. [https://training.fema.gov/is/searchis.aspx?search=PDS] Patricia Negron (Trish the Dish) used to be featured on George Webb's live streams, but she said that Webb used to take courses to get some kind of a certification from the DHS: "Someone asked if George Webb is an operative. And he definitely is some kind of an operative. Because one of the things I learned during this lawsuit was George kept trying to file to intervene, which drives up the costs for anyone who's involved. And so, he's filing all this sh*t again and again and again. And one of the things that he filed was a certification for the Department of Homeland Security, level 3, that he apparently got - I looked at the dates - during the time that I was doing live streams with him and Jason. And he never mentioned any of this. He would always say, he's going over to his son's house, or somewhere to meet with someone or something. He was doing this training program with Department of Homeland Security." [https://www.youtube.com/watch?v=jN6GL9_KfFs&t=49m13s] However I think Celeste might be genuinely Christian and genuinely interested in conspiracy theories, because the obituary of her husband mentioned that he and Celeste were devout Christians and that he was a fan of Steve Quayle: "In later life, David married Celeste Bishop. Together they walked in devout faith enjoying the Holy Scriptures, prayer, and worship. [...] Each day David arose and after reflection upon our Heavenly Father, Jesus Christ, and His Word, David would check the news going always to Steve Quayle's site first, a man he has admired for many years." [https://www.findagrave.com/memorial/202850518/david-phillip-solum] Celeste said that "when I was at FEMA, I was a source of Steve Quayle's." [https://www.bitchute.com/video/8VZTSaQXiPbn/, time 2:58] She was also a speaker at Quayle's True Legends 2020 conference. The first video on BitChute that features Celeste is an interview she did together with Steve Quayle on the Hagmann Report. [https://www.bitchute.com/search/?query=celeste%20solum&kind=video&sort=old] - Mark Steele: he is an anti-5G activist and a supposed DEW expert with a heavy British accent. He was one of the first people who started to say that COVID was caused by 5G, along with Greg Reese, Sacha Stone, and Robert David Steele. I don't know if EVENT 202 was originally supposed to be about 5G and not COVID, because many of its speakers were anti-5G activists, and the old website of EVENT 202 had three alternating banner images, where two of the images were about 5G and the third image was of a drone. [http://web.archive.org/web/20200501170954/https://event202.org/] The website of EVENT 202 was last updated in 2021, but at that time the content about the original EVENT 202 had been removed, and the website had been repurposed to promote a bunch of "health freedom rallies" in the UK, which appear to be extremely grassroots. [https://event202.org/] They had names like "A March For Freedom", "Central London Freedom Rally", "Unite for Freedom", "Worldwide Demonstration for Freedom, Peace & Human Rights", "We Do Not Consent!", "United Worldwide!", and "Medical Freedom March". David Icke was the main speaker in many of the rallies, and several of the British "freedom rallies" also featured a remote video presentation by Andrew Kaufman. [https://www.google.com/search?q=%22andrew+kaufman%22+british+freedom+rally] I haven't investigated the British rallies, but in 2019 in the United States, there was a rally called "Millions March Against Mandatory Vaccination" whose primary coordinators included Kevin Tuttle's organization Wisconsin United for Freedom and Erin Marie Olszewski's organization Florida Freedom Alliance. [https://nationandstate.com/2019/10/12/flvaxgate-controlled-opposition-vaccine-groups-in-florida-carry-out-sophisticated-cointelpro-type-operation] Both organizations were founded in 2019, and the domain names of both of their websites were registered in April 2019. Tuttle's LinkedIn profile has now been deleted, but it used to say that he worked as a "Public Affairs Officer" in the United States Air Force from 2001 to 2007. [https://i.ibb.co/rFdhHPM/kevin-tuttle-linkedin-public-affairs-officer.png] Tuttle's father moved to Israel and changed his name to Yeriel Even-Pinah. Olszewski wrote that she worked "in the antiterrorism units at MacDill Air Force Base in Tampa. Most of what happened there is stuff that I can't talk about. Even the fact that there is an antiterrorism unit there isn't known by many people." [https://books.google.com/books?id=Dn_rDwAAQBAJ&pg=PT91] Olszewski was previously virtually unknown, but when in 2020 she emerged as the "undercover epicenter nurse", she was interviewed the same day by InfoWars, Tucker Carlson, and Del Bigtree. The day before, her video about being an undercover nurse was posted on David Icke's website. When she first came out as the undercover nurse, some of the first people who mentioned her on Twitter were David Icke, his son Gareth, an Alex Jones fan account, the flat earth account ACSWorldNews, and a bunch of Qtards. [https://twitter.com/search?q=until%3A2020-06-11%20%28%22undercover%20nurse%22%20OR%20erin%20olszewski%29&f=live] A third ex-military anti-vaxxer is Dawn Jolly, whose LinkedIn profile says that she served as an "Operations Specialist" at the U.S. Navy from 2001 to 2003 and that she worked for Pfizer from 2014 to 2016. [https://www.linkedin.com/in/healthypatriot/] In 2019, Dawn Jolly founded an anti-vax non-profit called CT Freedom Alliance, and like Olszewski, she has appeared as a guest on Fox News. [https://wethepatriotsusa.org/617-2/] So I have found three different anti-vax organizations that have the word "Freedom" in their name and that were founded in 2019 by someone who calls themselves ex-military (which is a bit off-topic, but I was reminded of it by all of the British rallies that had the word "Freedom" in their name).

## Dawn Lester and David Parker

When I searched for the earliest tweets about Dawn Lester, the first tweet I found was from February 25th 2020 UTC about her appearance on The Higherside Chats podcast. [https://twitter.com/search?q=%22dawn%20lester%22%20until%3A2020-5-1&src=typed_query&f=live, https://twitter.com/HighersideChats/status/1232404772428206081] After that there were several other links about her interview with The Higherside Chats until a tweet from March 24th UTC which mentioned that she had also been interviewed by Crrow777. [https://twitter.com/bobduff80/status/1242428576244404225] After her interviews from THC and Crrow777, her third appearance in alt media I saw mentioned on Twitter was an interview she did with Andrew Kaufman. [https://twitter.com/CyberSpaceGod/status/1246202009897840646] I think Greg Carlwood who runs the Higherside Chats podcast is also a flat earther, because the description of his interview with the flat earther Eric DuBay said: "A multi-generational conspiracy has succeeded, in the minds of the masses, to pick out up the constant Earth, shape it right into a ball, spin it in circles, and throw it around the Sun! The finest cowl-up of all time, Nasa and Freemasonry's biggest mystery, is that we are residing on a plane, not a planet, that Earth is the flat, desk bound middle of the universe." [https://www.youtube.com/watch?v=cgXYdvN8wb4] The Higherside Chats has also interviewed other flat earthers like Crrow777, Jeran Campanella, Sofia Smallstorm, Marty Leeds, Freeman Fly, and Mark Devlin. In August 2017 when THC interviewed Jeran Campanella, they talked about Fomenko and New Chronology, even though it was before the Tartaria nonsense was popularized among flat earthers in 2018. [https://www.youtube.com/watch?v=g0h8Nc4yiMg] THC also did an interview with Eric Dubay in March 2015 which was really early on into the flat earth psyop. [https://www.youtube.com/watch?v=jZS0etOOeP4] In 2017, THC and Eddie Bravo's podcast co-hosted a live event which featured a debate about flat earth between the flat earther Eddie Bravo and some audience members. [https://www.youtube.com/watch?v=85Xw4UhA3Dg] The book "What Really Makes You Ill?: Why Everything You Thought You Knew About Disease Is Wrong" by Dawn Lester and David Parker was published at Amazon in December 2019. [https://www.amazon.com/gp/product/B082ZPVLZ5] A tweet from March 25th UTC showed that the book had only one customer review on Amazon, even though by April 2023 it had 1,240 reviews. [https://twitter.com/TaoistGroup/status/1242719542658371585] Someone who posted a blog comment in June 2020 wrote: "I checked on Amazon who is actually buying that book and giving it 5 star reviews (87% out of the 61 reviews). Most of them seem to be proud listeners of Crrow777." [https://sciencebasedmedicine.org/no-everything-you-thought-you-knew-about-disease-is-not-wrong/] On April 7th 2020, two new episodes of the Alchemy podcast by John Gibbons were released, where one episode featured Dawn Lester and David Parker as guests, and the other episode featured Wayne McRoy as a guest. [https://poddtoppen.se/podcast/531306530/alchemy/alchemy-099-dawn-lester-david-parker-what-really-makes-you-ill] Before that the podcast had been on a hiatus for 8 months, and after that it only continued for 9 more episodes, where the guests were Crrow777, David Icke, Max Igan, Jacob Liberman, Pierre Sabak, David Weiss, Tom Cowan, Amandha Vollmer, and Andy Breen (so at least 6 of last 9 guests are people who had started to say that SARS 2 does not exist by April 2020 and at least 4 of them have also said that the earth is flat). When Wayne McRoy did his alt media debut on Crrow777's podcast in 2017, Jason Lindgren said that McRoy was "somebody who's never done an interview at all". [https://www.youtube.com/watch?v=KHLhU43MibM&t=6s] McRoy was later been a recurrent guest on Crrow777's podcast and a co-host on Jason Lindgren's podcast. [https://www.crrow777radio.com/wayne-mcroy-playlist-free/] Almost all of the interviews on McRoy's Rokfin channel were done with flat earthers like Crrow777, Rose777, and Freeman Fly. [https://rokfin.com/waynemcroy] McRoy and Rose777 are also co-hosts of a podcast called "The New Poppycock Report". In a snapshot of Dawn Lester and David Parker's website from April 2020, there's links to a total of four interviews they had done at that point, which were the interviews with The Higherside Chats, Crrow777, Andrew Kaufman, and the Alchemy podcast of John Gibbons. [http://web.archive.org/web/20200427155343/https://www.whatreallymakesyouill.com/podcasts.html] In 2018, The Higherside Chats podcast did an interview with Neil Kramer who was a faculty member at the Omega Institute of Holistic Studies, and their next guest a few days later was Sofia Smallstorm. [https://podcastaddict.com/podcast/2019199] They have also interviewed Andrew Kaufman, Max Igan, Crrow777, and Sally Fallon Morell. There's a Twitter account called SoundwavePromo1 whose bio says: "I make clips for Sam Tripoli & The Higherside Chats! | Helping Creators Grow Their Audience! | Podcast Promoter". [https://twitter.com/SoundwavePromo1] His most recent tweets also included several tweets where he promoted Amazing Polly. [https://twitter.com/SoundwavePromo1/status/1766902356506218983] And he has also promoted David Weiss's Flat Earth Podcast. [https://twitter.com/SoundwavePromo1/status/1346559133407879168, https://twitter.com/SoundwavePromo1/status/1400110599292428294] David Weiss has a website where he posts links to videos by other people he has mirrored on BitChute, but in early 2020 he posted several videos by Amazing Polly (right next to videos which said that stones are petrified organs of titans and that viruses are not real). [https://stoplookthink.com/all-content/page/7/] Amazing Polly was an early player in establishing the narrative that the pandemic was fake, and she was one of the main people in alt media who was "exposing" Colleen Smith as an expert in medical simulation, along with her fellow Qtard Christine Polon, the flat earthers Karen B and Brian Staveley, and Jason Goodman.

## The End of COVID event, Kelly Brogan, and alchemy

In July 2023, there was an online event called "End of COVID" which consisted of a series of about 100 presentations that were mainly focused on the no-virus theory. [https://theendofcovid.com/] In the poster for the event, the "directors" of the event are listed as Kelly Brogan, the ex-military guy Alec Zeck, the flat earther Amandha Vollmer, Mike Winner, and Dawn Lester. I didn't know who Kelly Brogan was, but apparently she's a flat earther too, and there's a clip of an interview she did with David Weiss titled "Kelly Brogan - Emergency Landings prove FLAT EARTH. [clip]". [https://www.youtube.com/watch?v=RG_SLrAEZf4] The "producers" of the event are listed as The Way Forward (Alec Zeck), Alfa Vedic (Barre Lando and Mike Winner), and The Sovereign's Way (Greg Paul). The Alfa Vedic podcast has featured several flat earthers as guests, like David Weiss, James True, Marty Leeds, FPV Angel, One Conscience, Owen Benjamin, Sofia Smallstorm, Kelly Brogan, and Amandha Vollmer. And they have also interviewed Tartariatards who are closely linked to flat earthers, like Andreas Xirtus and Max Igan. Alfa Vedic is named after the "Alfa Vedic Gardens" which were established by Barre Lando and which "conformed to both Steiner Biodynamics and Permaculture principles". [https://www.alfavedic.com/about-alfa-vedic/] So Lando is a Steinerian just like Tom Cowan and Ralph White. One section on Alfa Vedic's about us page is about "Spagyric Alchemy", and in an interview that Barre Lando did with David Weiss, he said: "I have a my alchemical lab out there. And so what I like to do is step back and really look at again those larger patterns, and you know Hermetic principles have always been my guiding light." [https://www.youtube.com/watch?v=jduiNnyyPIA&t=8m9s] Amandha Vollmer's LinkedIn also says that her job position is "Alchemist". The fourth-oldest interview listed on Lester and Parker's website was an interview they did on the "Alchemy" podcast of John Gibbons. Their guests have included flat earthers like David Weiss, Crrow777, and Mark Devlin. For some reason there seems to be a lot of overlap between flat earthers and people who call themselves alchemists. James True and Crrow777 frequently discuss alchemy on their podcasts, and the flat earthers Amandha Vollmer and Benjamin Balderson call themselves alchemists. A bio of Kelly Brogan says that she "is a soul alchemist and threshold guardian devoted to the transformation of collective consciousness." [https://www.kellybroganmd.com/audacious-embodiment] On her website, Kelly Brogan offers a private coaching package called "40-Day Alchemical Container", which only costs 22,000 USD. [https://www.kellybroganmd.com/private-coaching-kelly] One of the products sold by Tom Cowan is Polyrhachis Ant Spagyric Tincture, which is "made from a specific type of ant, the Changbai Mountain Ant, then made into a spagyric or alchemically based tincture". [https://drtomcowan.com/blogs/blog/these-ancient-medicines-are-universal-tonics] And another product sold by Cowan is a "Spagyric Strophanthus tincture made by master alchemist Phoenix Aurelius, the same person who makes our Liposomal Vitamin C". [https://drtomcowan.com/blogs/blog/new-strophanthus-spagyric-tincture-now-available] Andrew Kaufman offers an "Alchemical Detox Course", where "you will be invited to participate in a special webinar called Alchemical Transformation, where you will be able to go over your questions and work on your detox plan with Dr. Kaufman", and where Kaufman "will teach you how the alchemical principles and steps will apply to your healing process and introduce you to Spagyric Medicine". [https://andrewkaufmanmd.com/the-alchemical-detox/] The guests on Alec Zeck's podcast have included Devon Graham who is "the pioneer of Alchemy Breathwork", Aubert Bastiat who "is devoted to anchoring the remembrance of who we are as children of God in the emergent paradigm through the necessary work of Masculine Alchemy and the dance and play of Sacred Union", and Xavier Dagba who "loves to think of himself as an emotional alchemist". [https://podcasts.apple.com/us/podcast/the-way-forward-podcast/id1532600628, https://www.deezer.com/en/show/2070422] In one podcast Sofia Smallstorm discussed "golems, dybbuks, the concealed project of alchemy, the Nanotech Pyramid, novel microorganisms, Clifford Carnicom, morgellons, the Holy Grail, and the importance of self work". [https://themeltpodcast.net/podcast/sofia-smallstorm-dybbuks-alchemy-and-the-holy-grail/] An article written by a 32nd degree Freemason said: [http://www.freemasons-freemasonry.com/alchemy_freemasonry.html] > Unbeknownst to most Masons, many of the symbols found in symbolic, or "Blue Lodge" Masonry came to us from Alchemy. In his book, "Symbolism of the Blue Degrees of Freemasonry"[4], Albert Pike describes these relationships and states that "By this and many other proofs we know that the symbols of Freemasonry were introduced into it by the Hermetic philosophers of England..."[5]. Manly P. Hall in his work, The Secret Teachings of All Ages, states, "...he [Hermes] was the author of the Masonic initiatory rituals...Nearly all of the Masonic symbols are Hermetic in character[6]".

## David Martin and Sacha Stone

In an interview with Alec Zeck in July 2023, David Martin said that viruses are not real, that nucleotides are not real, that DNA is not real, and that atoms are not real. [https://unite.live/the-way-forward/the-way-forward/19-jul-12-00-clarifying-the-viral-narratives-with-david-martin-phd-alec-zeck?video_id=936, https://expose-news.com/2023/08/10/there-was-no-sars-cov2-disease-just-a-set-of-symptoms-and-a-branding-campaign-dr-david-martin/] Alec Zeck said: "So just to be clear here, so when we're talking about a virus - I'm not talking about the previous definition of poison, I'm talking about a tiny replication-competent obligate intracellular parasite consisting of a genome surrounded by a protein coat that is an infectious particle." [39:50] And Martin told him: "All bullshit, 100% bullshit." Next David Martin said: "DNA does not exist." [42:41] Then Alec Zeck replied: "I don't disagree with that." And Martin said: "It doesn't." David Martin also said: "There are no atoms, there never have been, and there never will be." [44:52] And next he said: "The model of an atom then gives rise to the model of a thing we call a nucleic acid. Now, nucleic acids do not exist." One way to gauge whether some person in alt media is genuine or not is to look at which alt media outlets they did their earliest interviews with. If it's the Stew Peters Show like in the case of Sasha Latypova then they're probably phony. David Martin had appeared on several mainstream news outlets for years before COVID, but he did many of his first appearances on alt media with Sacha Stone. When I searched BitChute for the oldest videos about David Martin, the two oldest videos were mirrored from his YouTube channel, but the third-oldest video was about his presentation for Sacha Stone's "International Tribunal for Natural Justice" and the fourth-oldest video was an interview he did with Sacha Stone. [https://www.bitchute.com/search/?query=%22david%20martin%22&kind=video&sort=old] David Martin's "Fauci/COVID-19 Dossier" says: "This work was supported, in part, by a fund-raising effort in which approximately 330 persons contributed funds in support of the New Earth technology team and Urban Global Health Alliance." [https://www.co.yamhill.or.us/sites/default/files/BOC%20Public%20Comments%20052021.pdf] The description of an episode of Sacha Stone's NewEarth Horizon podcast says: "Support Dr. David Martin and NewEarth Media's Might Cause: www.lineinthesand.us/discovery to stay in contact: www.focusonfauci.com" [https://podcast.app/dr-david-martin-freedom-rally-dc-listing-felony-crimes-e126022364/] In January 2021, Sacha Stone's NewEarth Media organized an event called "Focus on Fauci" where the speakers were Judy Mikovits, David Martin, Robert F. Kennedy Jr., and Rocco Gallati. [https://truthcomestolight.com/focus-on-faucis-crimes-against-humanity-sacha-stone-robert-f-kennedy-jr-david-martin-rocco-gallati-judy-mikovits/] Robert David Steele was the "chief counsel" of Sacha Stone's LARPing operation called International Tribunal for Natural Justice. [http://web.archive.org/web/20190225225445/https://www.itnj.org/commission/commissioners/] In 2021, Robert David Steele organized the "Arise USA resurrection tour" which was supposed to culminate in the return of Donald Trump, or at least Steele was called the "visionary leader" of the tour. [https://bylinetimes.com/2021/06/13/capitol-indictment-reveals-radical-right-conservative-donors-simultaneously-bankrolling-extremism-and-anti-lockdown-protests/] In posters for the tour and on the side of the tour bus, there was text which said "CONSTITUTIONAL COUNTIES, FAITH, FAMILY, & FREEDOM", which is equal to 33 and 666. Posters for the tour also featured Sacha Stone and Leigh Dundas. The emblem of RDS's Earth Intelligence Network features a red Templar cross in the middle, which is similar to the red Templar cross that is featured in the emblems of Nordic rites of Freemasonry. [https://phibetaiota.net/about/, https://www.google.com/search?q=swedish+rite+freemasonry&tbm=isch] Robert David Steele's bio said that he was "Co-Founder of the Information Warfare Conference, founder of the Open Source Solutions Conference, invited lecturer worldwide on topics of Cyber, Open Source Intelligence (OSINT), (All-Source) Intelligence Reform, and Applied Collective Intelligence inclusive of holistic analytics, true cost economics, and Open Source Everything Engineering (OSEE) focused on achieving the Sustainable Development Goals (SDG)." [https://robertdavidsteele.com/about/] So the main focus of his Open Source Everything Engineering initiative was to achieve the sustainable development goals. His OSEE manifesto sounds like something written by Klaus Schwab, because it even says that his plan will lead to the second industrial revolution: "An Open Source (Technologies) Agency (OSA) is proposed as a starting point for the second industrial-informational revolution. Including a World Brain Institute, a Global Game, a School of Future-Oriented Design & Hybrid Governance, and a United Nations Open-Source Decision-Support Information Network (UNODIN), the OSA aspires to re-boot the crafts of intelligence (decision-support) and engineering (the heart of civilization) in order to achieve all of the Sustainable Development Goals (SDG) within a decade (two at the most) at 1/10th the cost of the current industrial-era processes." [https://robertdavidsteele.com/wp-content/uploads/2015/12/Open-Source-Everything-Engineering-OSEE-A-Nordic-Manifesto.pdf] In 2009, David Martin published a press release which said: "Dr. David Martin has been asked to serve on the Executive Board of the Climate Prosperity initiative coordinated by the Global Urban Development organization. The Global Climate Prosperity Agreement - 'The One Trillion Dollar Deal' - can become the worldwide game-changer that will demonstrate the positive path forward for human civilization in the 21st century, namely the peaceful transition from the current globally unsustainable economy to an advanced technology-driven and environmentally sustainable industrialized society. [...] The Global Climate Prosperity Agreement will help achieve the Millennium Development Goals in developing countries, by raising living standards and promoting sustainable economic and employment growth and sustainable business and community development through innovation, efficiency, and conservation in the use and reuse of all natural and human resources." [https://www.m-cam.com/2009/10/02/ma%C2%B7cams-david-martin-named-to-climate-prosperity-alliance-executive-board/] The chairman and CEO of Global Urban Development is the very gentile-sounding Dr. Marc A. Weiss. [https://globalurban.org/Green_Capitalism.pdf] An article written by Weiss said: "Climate Prosperity was launched in 2007. It is coordinated by Global Urban Development and Collaborative Economics, with financial support from the Rockefeller Brothers Fund and the Environmental Defense Fund." [https://globalurban.org/projects.htm] An article about the project said: "The Climate Prosperity Project is a new national initiative by the Rockefeller Brothers Fund and Global Urban Development". [https://jointventure.org/32-newsroom/news-releases/30-joint-venture-launches-silicon-valley-climate-prosperity-initiative] In 2005 M-CAM published a news item which said: "David Pratt provided two lectures on the importance of IP quality management in public interest initiatives. M·CAM has been a technology underwriter of PIPRA partnering its support to the financial support from the Rockefeller and McKnight Foundations." [https://www.m-cam.com/2005/page/2/] A bio of David Martin said: "He served as Chair of Economic Innovation for the UN-affiliated Intergovernmental Renewable Energy Organization and has served as an advisor to numerous Central Banks, global economic forums, the World Bank and International Finance Corporation, Allied Intelligence and Financial Security Agencies, and national governments." [https://cip.gmu.edu/frontiers/] "Allied intelligence agencies" might mean something like the intelligence agencies of five-eyes countries or NATO countries, because an article by the Center for Strategic and International Studies said: "More than 75 years of close collaboration has enabled GCHQ, NSA, and the other SIGINT elements of the Five Eyes alliance to codify a unique community and culture of shared knowledge, innovation, and capabilities. It is with an eye toward enabling the rest of the allied intelligence services to benefit from similar levels of collaboration that the authors propose this study's intelligence reforms." [https://www.csis.org/analysis/case-cooperation-future-us-uk-intelligence-alliance] Alessandro from Total Disclosure used to volunteer as a "community manager" for the International Tribunal for National Justice, which meant that he was responsible for things like uploading videos on ITNJ's YouTube channel, and he also helped run Sacha Stone's blog. He wrote a series of six blog posts about Sacha Stone, the ITNJ, and Sacha's friend Ciro Orsini (who bragged on the website of his restaurant that he belongs to one of the thirteen papal bloodline families). [https://totaldisclosure.net/deep-dive/sacha-stone-i/, https://www.spreaker.com/episode/fatal-to-expose-trafficking-itnj-sacha-stone-w-alessandro-castellon-2of2--19146488, https://www.pomodoro.co.uk/about] For example Sacha Stone received a 100,000 USD loan from a woman which he promised to pay back as soon as his free energy technology called "QT-Pi" would take off, but he never paid back the loan. [https://totaldisclosure.net/deep-dive/sacha-stone-ii/] After Kevin Annett began to expose the ITNJ as a fraud, Sacha Stone and Robert David Steele threatened to report him to "the authorities for psychiatric evaluation and possible removal from the public sphere". [http://murderbydecree.com/2019/03/20/urgent-public-and-media-advisory-notice-the-arrest-and-incarceration-of-kevin-annett-may-be-imminent-itccs-communique-of-20-march-2019/] Katherine Horton received similar threats from Robert David Steele. [https://stop007.org/home/black-list/robert-david-steele-cia/] Between April and June 2020, ITNJ published a series of seven "Corona Emergency Hearing" videos, where the star of the 4th hearing was Judy Mikovits and the star of the 5th hearing was David Martin. [https://commission.itnj.org/category/emergency-hearings/] A bit later of course Mikovits became the star of the first Plandemic film and David Martin became the star of the second Plandemic film. However Johanna Deinert who appeared as a "protected witness" in the 3rd ITNJ hearing said this about herself: "However, the protected witness clearly stated her objection to that opinion and introduced the work of Dr. Judy Mikovits to the panel. This led to her contact with Mikki Willis for the recording of 'Plandemic'". [https://twitter.com/53v3n0fn1n3/status/1747289013394812944] Sandra Rose Michael was one of the three "ITNJ commissioners" of the first hearing and the sole commissioner of the third hearing. She claims that she invented the Energy Enhancement System technology which is used in hundreds of healing centers that are operated around the world by Jason Shurka's organization UNIFYD. The technology actually consists of computer monitors which display a colorful moving graphical pattern, but Shurka claims that they produce scalar waves, morphogenetic fields, and biophotons. [https://www.thedailybeast.com/qanon-conspiracy-theorists-have-a-new-cure-all-dollar120000-tvs, https://www.unifydhealing.com/what-is-the-eesystem] A home unit of four Energy Enhancement System monitors only costs 14,995 USD. [https://eesystem.com/eeqube-from-eesystem/] Shurka's family are members of the Chabad of Port Washington, and in one book which was published in Shurka's name but which is supposed to have been originally written in Hebrew by his mentor Ray, they said that Ray was taken to an extraterrestrial planet called Nashia by Rabbi AA who was over 400 years old. During one of ITNJ's "Emergency Tribunal Hearing" held on April 13th, Alfred Lambremont Webre who was larping as a judge of the hearing said that the virus was an exosome: "Based upon the exhaustive findings of facts above, this tribunal finds that any and all mandatory quarantine - lockdown orders, mandatory vaccine orders, and our martial law orders made by national - any national, provincial, state, municipal, or disease control governmental or public entities - claiming alleged causal connection to the COVID-19 coronavirus, which in fact is an exosome as a high consequence infectious disease, HCI - are null and void under national and common law. No natural person anywhere shall suffer any penalty for ignoring any provision of such mandatory lockdown orders and/or martial law orders." [https://commission.itnj.org/2020/04/20/emergency-tribunal-hearing-corona-pandemic-and-the-planetary-shutdown-3rd-sitting/, time 7:28] Later during the same hearing, the "ITNJ Trustee" Thomas Brown also quoted a paper which said that "the virions of many viruses are complex and pleomorphic" and that "influenza virions therefore resemble exosomes both in their hydrodynamic properties and in their protein composition". [time 50:10] Mathew Crawford wrote: "When I met Imanee Oxum/Mamalution in January, she admitted to coordinated the No Virus team on message over a series of meetings." [https://roundingtheearth.substack.com/p/examining-rima-laibows-great-culling/comment/43247302] Imanee Oxum posted a link to a YouTube video by Tom Cowan on March 29th. [https://www.facebook.com/imanimamalution/posts/561494674486991/] In March 2020 she also posted several videos by Sacha Stone on Facebook, and she advertised Sacha Stone's 5GBioshield technology: "This is the 5GBioShield - the most advanced full-spectrum quantum nano-layer shielding technology. Not only is it an impenetrable shield from all harmful radiation > 2G 3G 4G 5G WIFI, it also and harmonized your home and family from all harmful imbalanced electric radiation by transmuting them to healing beneficial Tesla waves." [https://www.facebook.com/imanimamalution/posts/pfbid0NnbNp7M9mx5wnj4gpeKN9rfHYjJW8iXaVQsu8NXX2jUVvts5WWJhYJai5uZVtu9hl] She also wrote: "Watch this conversation with Sacha Stone and others. I will be hosting him in CT and LA in April as part of the 5G Tour and we will have the devices." [https://www.facebook.com/imanimamalution/posts/pfbid02bQjgELYzJ3q62MTCgPpsDTe7i8jfV3KX5HzSBqUtwaQyRrkNhZgB8jX8FVkXBwvxl] Imanee Oxum was also one of the participants in ITNJ's 4th "Corona Emergency Hearing" panel. [https://commission.itnj.org/2020/04/30/corona-emergency-hearing-4-dr-rashid-buttar-dr-judy-mikovits/] On a Facebook page called "New Earth Events" which promotes Sacha Stone's events, there was a repost of a Facebook post by Imanee Oxum which featured a poster for the Arise Freedom Tour. [https://www.facebook.com/permalink.php?story_fbid=pfbid0aQ6JZxoH2vwfCmVjpEsgjsykkJdVEzZQDhEBJQMiY4PC9wtzNXHNPRQmDFLgoJpHl&id=829963920372229] David Martin was the main star of the film "Plandemic II: Indoctornation" film by Mikki Willis. Mikki's twin sons are named Azai and Zuriel, which are both Hebrew names. [https://www.kveller.com/this-dads-reaction-to-his-sons-little-mermaid-doll-is-more-than-just-cute/, https://biographymask.com/mikki-willis/] Before he supposedly got "redpilled", Mikki Willis used to be the videographer of the communist Jew Bernie Sanders. [https://twitter.com/Perpetualmaniac/status/1258765560659292162] When Mikki made the first Plandemic film starring Judy Mikovits, he hired his friend Zach Vorhies to book interviews for Mikovits and to write tweets under her name. [http://web.archive.org/web/20200423204807/https://www.gofundme.com/f/help-me-amplify-pharma-whistleblower-judy-mikovits, https://www.youtube.com/watch?v=6awM9bZm2e4] In a tweet in 2019 where Zach Vorhies tagged his friends, he tagged a bunch of Qtards along with Mikki Willis. [https://twitter.com/Perpetualmaniac/status/1184845479365885952] The page for Vorhies at mylife.com has now been changed, but it used to say: "Zachary's ethnicity is Caucasian Jew, whose political affiliation is currently a registered Classical Liberal Larper; and religious views are listed as Christian Larper." [http://web.archive.org/web/20200423031655/https://www.mylife.com/zachary-vorhies/e910516938912] In 2019 Zach Vorhies became a whistleblower at Project Veritas who leaked documents about how Google discriminated against conservatives. Vorhies claims that the same day when he came out as a whistleblower on Project Veritas, he received the a text message signed "~Q" which said "Do not worry, you have guardian angels watching over you." [https://www.neonrevolt.com/2019/09/04/the-google-whistleblowers-message-from-qanon-greatawakening/] In 2018, Vorhies was the main eyewitness who was interviewed by the media about the 2018 YouTube HQ shooting, but his story was full of inconsistencies, and for example in a part of his interview with ABC7 which was later omitted, he said that the shooter was a man who was dressed in gray even though actually the shooter was female. [https://burners.me/2019/09/04/something-strange-about-the-google-whistleblower/] Steve Outtrim said this about Vorhies: "The mutual friends that I have - there are certain people that I have met, befriended even, who I either suspect or have direct knowledge of as being involved with either the deep state or DARPA or Pentagon. Or I suspect that maybe they're connected to intelligence. Some of these people I know for a fact that they've worked on DARPA projects. Some of these people - it's just that they're best friends with high-level DARPA people, and that they go and make videos with doctors from the CIA's MKULTRA program. [...] Out of like 13 mutual friends with him, four of them were the people that would be the top four on my list of everyone I know in Silicon Valley who I suspect to have these intel ties." [https://www.youtube.com/watch?v=mzp0dV7e5F4&t=16m57s] In 2022 the Jew Jane Ruby organized an event called "Pharmaceutical Insider Expose" at Palm Beach where the speakers consisted of David Martin, Sasha Latypova, Karen Kingston, and Mike Yeadon. [pfizerstew.html] In late 2022, Latypova, Kingston, and Yeadon all started to promote a similar no-virus-lite theory as J.J. Couey, where they claimed that COVID was not caused by a virus, that viruses are not capable of causing pandemics, and that gain-of-function research is not actually that dangerous. Yeadon was the vice president and chief scientific officer of Pfizer's division for respiratory and allergy research. Karen Kingston has said that she used to be a "top-performing cardiovascular specialty representative with Pfizer" and that afterwards Pfizer was one of the clients of her consulting firm. Latypova was a co-founder of iCardiac Technologies which did a multimillion-dollar deal with Pfizer in 2007, and before it she worked for VirtualScopics whose lead client used to be Pfizer. As far as I know, Latypova did her alt media debut in January 2022 on the Stew Peters Show, and she's pushing Stew psyops about hydrogel and about self-assembling structures found in COVID jabs. Karen Kingston did her alt media debut in July 2021 on the Doug Billings Show, which is aired on a cable TV channel which also airs the Stew Peters Show, and two weeks later she appeared on the Stew Peters Show. Kingston has said that COVID vaccines contain hydras, snake venom, graphene oxide, and hydrogel. When people were saying that the logo of Martin's company M-CAM looks like a Masonic compass placed in front of a Masonic apron, Martin published a Facebook post where he denied that his logo had Masonic influences, but he wrote: "While my grandfather and great grandfather were both Masons, our logo has no similarity to those symbols. My great grandfather had numerous connections to the Masonic influence in Washington DC including having a rather interesting involvement with the construction of the Washington monument. While Masonic symbols do contain important geometric elements, they are not informed by the magnetism that begets and sustains life." [https://www.fluoridefreepeel.ca/wp-content/uploads/2021/11/David-E-Martin-logo.png] David Martin's great-grandfather Jesse C. Suter was the chairman of the committee which selected the flag of Washington DC. [https://twitter.com/HousatonicLive/status/1701006920289751272, https://sites.google.com/housatonicits.com/home0009/research/jesse-courtney-suter-b1872, https://en.wikipedia.org/wiki/Flag_of_Washington,_D%2eC%2e] Jesse C. Suter was also the president of an organization called "The Oldest Inhabitants of the District", and he wrote that in 1941 on the 150th anniversary of the Patriot Day, the event was celebrated in DC under the joint auspices of his organization and two different Masonic lodges: "It is recalled that on April 15, 1941, the one hundred and fiftieth anniversary of the event was pictureequely celebrated under the auspices of a joint committee of the Masonic Grand Lodge of the District of Columbia, the Association of the Oldest Inhabitants of the District, the Alexandria-Washington Lodge, of which George Washington was at one time the worshipful master, and officers from the Washineton Board of Trade." [https://books.google.com/books?id=UJXTcX-U3-sC&pg=SL1-PA2792] In 1952 Jesse C. Suter was also celebrating George Washington's birthday together with a bunch of Masons: [https://chroniclingamerica.loc.gov/data/batches/dlc_2nevelson_ver01/data/sn83045462/00280605803/1952022101/0592.pdf] > The Advisory Board of the Masonic Clubs of the District will' place a memorial wreath at the Washington Monument at 9:30 am. tomorrow. Delegates from Masonic clubs in Maryland and Virginia have been invited to attend. > The observance will be followed by an address by Rena F. Camalier, grand master of Masons of the District. > The Association of Oldest Inhabitants of the District will hold a birthday observance at 11 a.m., in the Old Engine House, Nineteenth and H streets N.W. Judge James R. Kirkland of District Court is scheduled to make the principal address. > The program will include remarks by Jesse C. Suter, president of the association; an invocation by the Rev. Hirl A. Kester; the reading of Washington's Farewell Address by Kirk C. Miller, and the recitation of an original poem by John Clagett Proctor. When Jesse C. Suter died, the Association of the Oldest Inhabitants announced in a newspaper that their president emeritus had passed away, and next to it there was another another announcement which said that a Masonic service for Jesse Suter was conducted by Joppa Lodge, No. 35. [https://twitter.com/FringeViews/status/1776620673130995799/photo/1, https://www.newspapers.com/search/?query=%22SUTER+JESSE+COURTNEY%22, https://www.newspapers.com/image/871607792/] David Martin might also be related to Reverend Henderson Suter, who gave the dedication prayer during the inauguration ceremony of the Washington Monument in 1885 (which no surprise also featured a Masonic ceremony): "Other dignitaries who delivered a speech at this event were Ohio Senator John Sherman, the Rev. Henderson Suter and Freemason Myron M. Parker. William Wilson Corcoran, of the Washington National Monument Society, was absent and his speech was read by Dr. James C. Welling. It was succeeded by a brief Masonic ceremony and a speech by the Engineer of the Monument, Col. Thomas Lincoln Casey of the Army Corps of Engineers." [https://historictruthopedia.com/p-r-a-y-e-r-at-the-dedication-of-the-washington-monument/, https://edtimes.in/washington-monument/] I thought Jesse C. Suter may have been a grandson of Henderson Suter, but I found a family tree which includes 7 children of Henderson Suter and some of their children, but none of them are named Jesse (even though it could be that some of Henderson Suter's children or grandchildren are missing from the genealogy). [https://www.angelfire.com/realm3/ruvignyplus/036.html] And also Jesse Suter's obituary said that his father was named George. [https://sites.google.com/housatonicits.com/home0009/research/jesse-courtney-suter-b1872] During the Capitol Riot in 2021, David Martin posted a photo on Instagram of a large mass of people gathered around the Washington Monument, with the text: "We are all here on purpose at this moment in time. January 6, 2021". [https://www.instagram.com/p/CJ1_a68Aw7P/] David Martin has an eye of Horus tattoo on his shoulder, the default thumbnail for articles on his website contains an eye of Horus, and in one of his headshot photos he is wearing a bowtie with an eye of Horus pattern. [https://www.instagram.com/p/CFsmzq4Bgf-/, https://www.m-cam.com, https://waterside.com/wp-content/uploads/DEM-Headshot1-Press-Photo-687x1030.jpg] Manly P. Hall wrote that "Operative Masonry, in the fullest meaning of that term, signifies the process by which the Eye of Horus is opened." [https://sacred-texts.com/eso/sta/sta18.htm] David Martin's brother Daniel Martin was one of the 31 authors of a report about Ebola by WHO titled "Join External Evaluation of Sierra Leone: Mission Report November 2016", and another author was James Bangura who was listed as being affiliated with the PREDICT program of Metabiota. [https://twitter.com/HousatonicLive/status/1698813230183747594, https://mohs2017.files.wordpress.com/2017/06/ihr-joint-external-evaluation-mission-report-2016.pdf] Out of the five authors of the Proximal Origin paper, four were also authors of papers which established the narrative about the origin of the 2014 Ebola outbreak. [https://twitter.com/CharlesRixey/status/1697877244721385726] The WHO sent Metabiota to Sierra Leone to monitor the Ebola outbreak in 2014, where Metabiota shared a lab with Robert Garry's Tulane group, but Metabiota was kicked out of Sierra Leone because of their poor handling of the Ebola response. [https://www.cbsnews.com/news/american-company-metabiota-problems-during-ebola-outbreak/] David Martin said that he had a role in the investigation of the 1995 Tokio subway sarin attacks: "There's no question that the Tokyo subway bombing - which was something that I had the privilege of being part of the investigation team on - there's no question in my mind that somebody got into the air ducts in the Tokyo subway system and murdered people with an aerosolized agent, and there's no question that the aerosolized agent was derived from a natural substance." [https://unite.live/the-way-forward/the-way-forward/19-jul-12-00-clarifying-the-viral-narratives-with-david-martin-phd-alec-zeck?video_id=936, time 1:08:58] (But since the subway attacks were likely a false flag, the people who were selected to investigate the crime may have been working for the perpetrators, like was the case with the 9/11 Commission.) In 2021 Kevin McKernan posted a Twitter thread about why Martin's claims about coronavirus patents were bogus. [https://twitter.com/Kevin_McKernan/status/1415360625283379206] McKernan also discussed Martin's patent claims in an interview with Bretigne Shaffer in 2021. [https://www.bitchute.com/video/mS1ItCqCv9T9/] David Martin is also one of the people who is promoted by Miles Guo's Twitter bots, which have posted a large number of clips of David Martin's videos with Chinese subtitles. [https://twitter.com/search?q=lang:zh+%22david+martin%22&f=live] In a blog post in 2023, David Martin wrote: "David Lopez left an indelible mark on this year. Through his fraternity and generosity, my life was enriched in every dimension. His passion for distributing the important public messages I had to share amplified the great contributions of Mikki Willis, the late Dr. Zev Zelenko, and countless others expanding the reach of conversations with Seth Holehouse, Tommy Robinson, Russell Brand, and the appearances at the EU Parliament (organized by the ICS) and the UK Parliament (at the invitation of John Bowe and MP Andrew Bridgen). His brother Daniel recalibrated my social media reach on X and other platforms. In business, he facilitated the invaluable connection to global luminaries like Robbie Lavia, Ahmed Bin Sulayem, John Eleoterio, Tom Williams, Ernie Lee, Xavier Adsera, and many more. Above all, David stood shoulder-to-shoulder in every moment of the year affording me what few in life ever experience – fidelity above and beyond duty." [http://www.invertedalchemy.com/2023/12/setting-sights-on-2024-with-gratitude.html] David Lopez is the cofounder of The Wellness Company and the CEO of Zelenko Labs. His bio says that he served as a special project manager for Blackwater: "David Lopez served as a U.S. Navy SEAL and is a Subject Matter Expert (SME) on Tactical Operations, Classified Global Counter-Terrorism Operations/Terrorist Countermeasures, Protection, Security and Close Quarter Combat (CQC) tactics. Mr. Lopez has a tremendous depth of experience in these areas and has highly specialized training in support of classified intelligence operations. Beyond this, his intense military training and experience is invaluable since he understands critical process performance and can advise on optimization for a variety of areas beyond these fields. Since leaving the U.S. Navy, Dave has trained over 20 SWAT teams around the U.S. in advanced tactics and Close Quarters Combat (CQC). He has also instructed numerous Special Response Teams (SRT) of the Department of Homeland Security. Dave Lopez has conducted multiple rescue missions with Operation Underground Railroad, an organization that pursues sex traffickers around the world, which directly led to the rescue of over 200 children and the arrest of over 50 traffickers. He now serves as a special projects manager for Blackwater and conducts security operations around the world for select clients." [https://missionsixzero.com/our-team/david-lopez/] (David Martin's blog is called "Inverted Alchemy", which is interesting considering how all the no-virus guys call themselves alchemists or they sell expensive online courses in spagyric alchemy.)

## Robert David Steele

I'm not sure if Robert David Steele claimed that viruses in general don't exist, but he was one of the first people who started to say that the pandemic was fake and that COVID was caused by 5G, and he was the first person I found who connected COVID to Arthur Firstenberg's book _Invisible Rainbow_. The earliest video or article I found which said that COVID was caused by 5G was a video by Mark Steele which was published at YouTube on January 28th in an unknown timezone. [https://twitter.com/search?q=5g+coronavirus+until:2020-01-29+lang:en&f=live, https://wickedtruths.org/en/video-list-5g-microwave-weapons-microwave-radiation-poisoining/] Next the theory was mentioned on January 29th in an unknown timezone by Richie from Boston and in a report that Greg Reese did for InfoWars. [https://altcensored.com/watch?v=R7oMkWPvz10, http://web.archive.org/web/20200131123524/https://www.infowars.com/5g-launches-in-wuhan-weeks-before-coronavirus-outbreak/] Next on February 3rd UTC, Robert David Steele published a video about the theory together with Sacha Stone and Mark Steele, and on February 3rd UTC Max Igan also posted a video about the theory. [https://www.bitchute.com/video/nBdVf-8W9yc/, https://www.bitchute.com/video/nBdVf-8W9yc/]. And on February 9th in an unknown timezone, Robert David Steele published a long blog post about the theory that 5G causes COVID. [https://phibetaiota.net/2020/02/robert-steele-china-coronavirus-my-appraisal/] On March 10th in an unknown timezone, RDS published a memorandum to Trump where he wrote the following: [https://phibetaiota.net/2020/03/robert-steele-memorandum-for-the-president-on-coronavirus-covid-19-5g-new-biowar-attacks-need-for-counterintelligence-study/] > This appears to have started as a combination of a Zionist-German-French-Gladio biological "drop" across Wuhan beginning around 9 September 2019 when Angela Merkel first visited Wuhan; a "cover story" built up around the hapless Jewish American professor at Harvard - the Lee Harvey Oswald in what is in effect China's JFK/9-11/Chernobyl/Fukushima combined; the 5G aspect that you are being lied to about to this date; and a contrived media information war intended to wreck the Chinese, US, and global economies - and your re-election - for both insider profit taking and Deep State advantage over you. The Wuhan lab is the pre-planned "culprit". > Subsequently anomalous numbers in Iran confirm the contrived nature of this attack; the mis-diagnosed cases around the world generally coincide with 5G networks that have at a minimum lowered immunity and at worst been used to create biological diseases. The lack of fatalities is today's good news. > 2. New Threat. Evidence is emerging that new biological drops are taking place, possibly using nano-technology such as micro-UAVs; and that 5G is being leveraged to continue to create many cases of radiation sickness being mis-diagnosed as coronavirus. On March 19th UTC, RDS published a BitChute video titled "Sacha Stone Heard from God -- Here's What She Said About the Virus". [https://www.bitchute.com/video/Bmg1cwxar_M/] I believe Sacha Stone did not yet say that the virus does not exist, but he said that the virus was innocuous and that COVID may have been caused by 5G, or that people may have been placing canisters of bacteria to strategic locations around cities which produced a temporary outbreak of disease. And he said: "So deep state detox, under the smokescreen of an engineered somewhat innocuous virus - which by best accounts is not much worse than a household flu - that to me is a very clever way of these so-called white hats engineering a scenario which forces the world into a slow down at every level, so they can begin the process of getting paramilitary forces and SWAT teams onto the streets of towns, cities, villages all around the world and cherrypicking probably over a half a million operatives - bad actors - who need to be removed from their positions." [time 3:02] In March 2020 RDS also published an interview with Benjamin Fulford, who also said that the virus was no worse than the flu, but the lockdowns were engineered as a cover so the white hats could arrest the bad guys. [https://www.bitchute.com/video/t49kxpSA1_w/] On March 3rd 2020 UTC, Benjamin Fulford published a blog post which said that "The fake coronavirus pandemic now being promoted around the world is aimed at creating a world republic, P3 Freemason sources say." [https://benjaminfulford.net/pandemic-show-aims-to-launch-world-government-project-blue-beam-next/] In the same post he quoted a post by Robert David Steele which said that "President Donald Trump has publicly declared the coronavirus a hoax but has been forced to backtrack by the political circus." On March 25th UTC, RDS published a BitChute video titled "Former Spy Tells President Trump Truth in Nine Minutes - Fake Pandemic, 5G Triggers, Purge Needed". He said: "Now I was the first to say that this was a false pandemic. I was the first to tie in 5G which lowers immunity. And I'll come to 5G as a trigger system in a minute. But let's just look at this: that tiny little blue sliver is deaths that can actually be attributed to coronavirus. Everything else is preexisting conditions. And over here we have all of these guys that were previous fake pandemics. [...] Now here's the last slide - I gotta give a tip of the hat to American Intelligence Media - you can find these two slides at TinyURL, and of course the original American Intelligence Media article. Here's what it boils down to. The coronavirus - a bioengineered virus - contains nanoparticles that can be activated on a time-phased arrangement by 5G, ok. Which means that this whole thing could be phased out, and every time we think we have a grip on it: boom, another spurt comes up and induces fear." [https://www.bitchute.com/video/giiDPiEioe0/, time 5:33] Douglas Gabriel and John Barnwell from American Intelligence Media are anthroposophists who have started a movement called "neoanthroposophy", which is interesting because Tom Cowan is also an anthroposophist. Douglas Gabriel claims that he worked as a cryptologist for the NSA and he used to be a Jesuit priest, and John Barnwell claims that he is a Templar (but they might be lying because Douglas Gabriel also claims that he is an exorcist, a clairvoyant, and a ghostbuster). Douglas Gabriel published an article where he wrote about how Blavatsky said that Jesuits were trying to infiltrate anthroposophy, and then he wrote: "I was also a Freemason and by firsthand experience know its link to the Society of Jesus (Jesuits). But at the time I was infiltrating anthroposophical communities around the world on behalf of my mission with the Society of Jesus, I had no idea that Blavatsky's indications about the Jesuits would come to pass 'with a passion.'" [https://neoanthroposophy.com/2017/02/04/jesuit-spies/] Rudolf Steiner was the master of a Masonic lodge called _Mystica Aeterna_, and in his 20s and 30s was an editor at the Goethe archives and he wrote two books about Goethe, but Goethe was another Freemason. [https://www.universalfreemasonry.org/en/famous-freemasons/rudolf-steiner] Douglas Gabriel wrote: "To believe that Rudolf Steiner 'invented' his own freemasonic work without building on the work of the Memphis & Misraim Lodge is simply naïve. No doubt Steiner changed the rites to serve his purposes but the rituals he used are very similar to those of the Misraim Lodge. Note the connection between the OTO and the Misraim Lodge in Germany with Theodor Reuss in the quote below." [https://neoanthroposophy.com/2017/02/08/the-secrecy-of-the-first-class-the-circle-steiner-freemason-and-the-first-goetheanum-fire/] In a YouTube video where Douglas Gabriel listed all of the spiritual practices he had been initiated into, he said: "But yes, Summit Lighthouse - I went through actually technical things, Aquarian Foundation. [...] Uh, Masonry, the blue lodge of course, leading to all the other degrees. [...] So that was the way it was with the Mormons, Swedenborg, the I AM Temple, of course, you know, I went through the training." [https://www.youtube.com/watch?v=-h0sY3VlVXY&t=5m30s] The I AM Temples are operated by the Saint Germain Foundation, which was founded by Guy Ballard, who claims that in 1930 while he was hiking at Mount Shasta, Saint Germain appeared to him and began training him as a messenger. [https://en.wikipedia.org/wiki/Saint_Germain_Foundation] The Summit Lighthouse was an offshoot of Ballard's movement, and it was started by Mark Prophet who claims that he was instructed to found the Summit Lighthouse in 1958 by the ascended masters El Morya and Saint Germain. [https://www.summitlighthouse.org/summit-lighthouse-great-white-brotherhood/] In an interview with Benjamin Fulford published on March 27th UTC, Robert David Steele said: "There's also a lot of fakery then. For example in New York City they're talking about morgues and emergencies and bodies overflowing, and citizen journalists going there are finding zero. Zero." [https://www.bitchute.com/video/CRffTaPc3Cs/, time 2:12] By citizen journalists, he may have meant Jason Goodman, who was doing the same schtick as George Webb where he called himself a citizen journalist and he traveled to different locations shooting Periscope videos about stories he covered. When I searched for early tweets about the trend where people were filming empty hospitals in order to show that the pandemic was fake, the earliest tweets I found were posted by Jason Goodman around March 16th, so he may have in fact started the whole trend of filming your hospital, and he also tweeted that "I think I may have visited more hospitals than anyone else, at least that I'm aware of". [https://arkmedic.substack.com/p/there-was-no-virus/comment/42272038, https://twitter.com/csthetruth/status/1244399390086889474] The oldest tweet I found with the hashtag "#filmyourhospital" was posted on March 29th UTC by DeAnna Lorraine, who now has a show on the Stew Peters Network. [https://x.com/search?q=%23filmyourhospital%20until%3A2020-3-30] In an interview with Sacha Stone that was published on April 1st UTC, Robert David Steele said: "We have wrecked a 20 trillion dollar economy for what appears to be a massive medical simulation. The deaths are just not there." [https://www.bitchute.com/video/m4Qx_7FDunE/ / https://altcensored.com/watch?v=m4Qx_7FDunE, time 0:10] On March 25th local time, the New York Times published a viral video by Colleen Smith which showed that Elmhurst Hospital in Queens was overran with patients, but over the next few days, she was "exposed" an expert in medical simulation by people like the Qtards Christine Polon and Amazing Polly, Jason Goodman, and the flat earthers Karen B and Brian Staveley. Jason Goodman even interviewed Colleen Smith over the phone. So RDS probably referred to the Colleen Smith video when he said that COVID was a medical simulation. My theory is that the Colleen Smith video may have been a psyop that was targeted against conspiratards to make them think that the pandemic was fake, so that it may have been part of the plan that people would end up discovering that she was an expert in medical simulation. But anyway, next during the interview with RDS, Sacha Stone said that "a virus is an excretion from living cells that happens as a detoxification phenomenon", and he talked about the _Invisible Rainbow_ book and he said that COVID was caused by 5G, and then RDS said that he had a 17-page summary of the book on his website. Tom Cowan also published a review of the _Invisible Rainbow_ book on his blog in December 2019, so I don't know if he was already being coached on the no-virus narrative before the pandemic. [https://drtomcowan.com/blogs/blog/a-big-change-in-emfs-preceded-each-pandemic] During the same interview with RDS, Sacha Stone also said that social distancing causes AIDS: "So if you are trying to turn people to cloister indoors and stay out of sunshine, and stop hugging their grandchildren, and stay three meters away from each other, you just f***ed up in an unholy way. What you've done is assured autoimmune deficiency. Incidentally, that's called AIDS." [11:12] Then Robert David Steele gave Sacha Stone a virtual fist bump and smiled and nodded in agreement. In October 2020 Robert David Steele published an article on his website which said: "According to the Taygeteans, there is no virus and never was one. The current pandemic is a HOAX." [https://phibetaiota.net/2020/10/cosmic-agency-covid-19-virus-hoax-does-not-exist-do-not-take-the-vaccine-it-has-been-weaponized/] (That's even better than Benjamin Fulford, whose sources are always something like "Mossad sources say" or "sources say". But I haven't heard "According to the Taygeteans" before.) But anyway, I don't even think the article about Taygeteans was even reposted on RDS's website from some other source because I didn't see it published anywhere else. However I don't know if the article was written by RDS himself, because his website had a couple of other articles about the Taygeteans whose author went by the name of Yoda, and one of them included additional comments by some lady named Ann Delap. [https://phibetaiota.net/2020/09/yoda-cosmic-agency-video-series/] The Taygetean extraterrestrials are supposed to be channeled by people on a YouTube channel called Cosmic Agency, which is ran by some Polish lady called Gosia Duszak, who claims that in 2017 she initiated a "direct contact with a Taygetan/Swaruunian race (Pleiades) crew aboard the Toleka ship in Earth orbit". In another article RDS included this comment from a reader: "It may interest you to know that the Taygeteans also believe JFK Jr. is alive. Gosia posed the question to Aneeka in a recent video, and that was her response." [https://phibetaiota.net/2020/07/robert-steele-jfk-jr-is-alive-80/] On February 20th 2020 UTC, the fake judge Anna von Reitz wrote that the Spanish flu was caused by aspirin and COVID was caused by 5G, and she wrote: "Those who have been following along with recent posts have become familiar with research going back more than a century compiled and published by Arther Firstenberg in his book, The Invisible Rainbow, and brought forward by Robert David Steele." [http://annavonreitz.com/torpedoesaway.pdf] When I searched Twitter for the phrase "Invisible Rainbow" in double quotes, the oldest tweets I found which referred to the book in connection to COVID were posted on February 18th UTC and they linked to a blog post by Robert David Steele. [https://twitter.com/search?q=until%3A2020-2-20%20%22invisible%20rainbow%22&f=live, https://phibetaiota.net/2020/02/arthur-firstenberg-the-invisible-rainbow-a-history-of-electricity-and-life-radiation-sickness-explains-all-past-and-present-flu-outbreaks-including-wuhan-virus-and-radiation-sickness-on-cruise-shi/] In an interview that Robert David Steele did with Anna von Reitz in 2019, he told her that "along with Ben Fulford and Wayne Jett and Martin Armstrong and a few others, I consider you one of the few true seers." [https://www.bitchute.com/video/YnHwh3LJ6fHh/, time 00:40] Anna von Reitz was one of the proto-Q people like Benjamin Fulford who were talking about topics like NESARA and GESARA long before Q. In 2018 she also wrote that there would be an "Operation Clean Sweep" where bad players in the deep state would be arrested and that "about 70,000 indictments have been processed thus far". [http://annavonreitz.com/warningsandarrests.pdf] RDS's blog had a long about COVID which was originally dated Feburary 7th 2020 but which was later edited many times, and its title was later changed to "Robert Steele: FAKE PANDEMIC It's OVER! [President is Correct - This is the New Hoax aka False Flag.]". The oldest version of the article may not have yet said that the pandemic was fake, but the oldest snapshot of the article at web.archive.org is from February 27th UTC and it already said that "there is no virus threat" and that "they know this is all fake, no vaccine for radiation sickness". [http://web.archive.org/web/20200227153055/https://phibetaiota.net/2020/02/robert-steele-china-coronavirus-my-appraisal/] Robert David Steele is supposed to have died of COVID on August 29th 2021 (even though he is one of the last people I would trust to not have faked their own death). But anyway, 12 days earlier he posted a blog post which said the following: [https://phibetaiota.net/2021/08/roberts-condition-08-17-2021/] > With love to all of you, I survived! I went in at 77 oxygenation. I'm up to 94. I will not take the vaccination, though I did test positive for whatever they're calling "COVID" today, but the bottom line is that my lungs are not functioning. > The good news is that I will survive with a few days off. I should be back up and at least functional soon. This is been a near death experience, very much like a new death experience the whole country is going through right now. We will never be the same because now we know that we've all been lied to about everything. But, now we also know that we can trust each other. I'm alive today because I had a network that put me into a good hospital in Florida. In a book titled "The Handbook of Fifth-Generation Warfare", there is a timeline which describes the origins of the term "fifth-generation warfare", but the very first entry on the timeline is the following: "August 29, 2003: An apparent press release from OSS.net, through PRNewswire, in Windows .doc format, detailing need for fifth-generation tactics to create 'the necessary new national security paradigm,' as described by Robert David Steele (Steele 2003)." [https://dokumen.pub/the-handbook-of-fifth-generation-warfare-9781934840177-1934840173.html] So RDS might possibly deserve the title of the father of fifth-generation warfare.

## Duesberg and company

In the first months of COVID, I revisited various old conspiracy theories about viruses, so I also read articles about HIV by people like Peter Duesberg, the Perth Group, John Lauritsen, Stefan Lanka, Bryan Ellison, Janine Roberts, and Kary Mullis, and I even posted an audiobook of Duesberg's book on BitChute. But I have since then learned more about virology, and I now believe that Duesberg was a disinformation agent whose task was to cause division among HIV dissidents and to draw their focus away from the laboratory origin of HIV, which is a view that is shared by Alan Cantwell, Len Horowitz, and Cantwell's protege St. Nick: - Cantwell died in 2021, but his last interview in alternative media was done in 2019 by Len Horowitz and Sherri Kane. [https://revolutiontelevision.net/video/aids-origin/] Some of Cantwell's articles have been posted at whale.to. [http://www.whale.to/vaccine/cantwell.html] In 1991, Cantwell did a video interview about his book _AIDS and the Doctors of Death_. [https://www.youtube.com/watch?v=6-BlE9dWqWU, https://www.youtube.com/watch?v=D8J5ORRZTlc] - There's a 2-hour video of a presentation that Horowitz did in 1997 on the _Emerging Viruses_ book tour. [https://t.wtyl.live/w/ie3Ybv7Q6jFwcrPsr2Vaew] He wrote about Duesberg in a section of his book titled "Notes on Duesberg". [https://survivorbb.rapeutation.com/viewtopic.php?f=194&t=2026&start=10] Horowitz's website also has an article about Duesberg. [https://medicalveritas.org/aids-deniers/] - Nick has posted presentations about the origin of HIV on Rumble. [https://rumble.com/v35uewu-medical-anthropology-presentation-001-redux.html, https://rumble.com/v1x5vi4-medical-anthropology-presentation-002.html] He has also published a timeline of the laboratory origin of HIV. [https://sites.google.com/antioch.edu/iatrogenic-timeline/home] Aaron Baalbergen from FactBid is another good researcher of HIV origins: https://twitter.com/factbid/status/1738285562782474353, https://twitter.com/factbid/status/1746318437918347407. Ed Hooper wrote a book about the laboratory origin of HIV titled _The River: A Journey to the Source of HIV and AIDS_. It was originally published in 1999 but in 2021 it was released as a free online edition. [http://www.aidsorigins.com/wp-content/uploads/The-River-by-Edward-Hooper-2021-edition.pdf] In the book, Hooper wrote: > I spent an afternoon with Peter Duesberg at his Berkeley lab in the summer of 1990, and during the course of a four-hour interview, he explained the basis for his position. For most of that time he appeared confident and persuasive. But on two or three occasions, when I asked a question about the African epidemic, for instance, he got up and left the room, and returned five minutes later already talking about Koch's postulates, or some other unrelated argument.[91] > [...] > 91. A few examples. I asked why, when an HIV-positive and an HIV-negative child were born to an HIV-positive mother, only the first child went on to get AIDS. Such anecdotal stories, he replied, are worthless unless reproduced in large numbers. (This is a valid point, but one that he tended to use ad infinitum.) I asked him about Patricia Fultz's work: How could a pure clone of a highly virulent form of SIVsm cause simian AIDS when introduced into macaques and SIV-negative (but not SIV-positive) sooty mangabeys? He said that we could not be sure that the clone was uncontaminated with other organisms. When I asked why rural people in Africa had themselves recognized AIDS, or Slim, as a new condition, he insisted that he saw nothing new, but only old diseases under new names. It's also suspicious that Duesberg's coauthor for the book _Inventing the AIDS Virus_ was the Chabadnik Bryan/Boruch Ellison. He runs two websites where he teaches the gentiles how they can avoid being decapitated once the Jews begin to enforce the Seven Noahide Laws. [http://noahide.com, http://hasidicuniversity.org] For example he wrote that the mandated punishment will be "Death from Heaven" for people who "accept the Veda, the New Testament, the Quran, or the Book of Mormon as legitimate revelations". [http://www.hasidicuniversity.org/index.php?page=hu_theocracy/mitzvah_profile.php?mitzvah=-313] His organization JAHG-USA had a campaign to abolish the celebration Christmas because they said it will be punishable by death under Jewish Theocratic Law. [http://noahide.com/infiltration/xmas.htm] Ellison also says that Palestinians did 9/11. [http://www.attacreport.com]

## Stefan Lanka on genetic sequencing and assembly

The following is Stefan Lanka's explanation for how the genetic sequencing of viruses works: [http://wissenschafftplus.de/uploads/article/the-end-of-corona-a-chance-for-everybody.pdf] > Based on the sequence data generated in the first round of nucleic acid propagation, short pieces of nucleic acids are biochemically generated for the propagation of nucleic acids by PCR, so-called primers. These artificially generated primers themselves yield, depending on the protocol, approximately 4-20% of the sequence alignment of what is ultimately presented, after this second step of PCR propagation, as the sequence alignment of SARS-CoV-2. This second PCR propagation step for the subsequent mathematical, called bioinformatic formation of the sequence is called, among other things, deep meta-transcriptomic sequencing. The fact that an extremely unscientifically high number of cycles of PCR is applied here (35-45, so-called Ct value), in which artificial nucleic acid sequences are automatically generated that do not exist in reality, is further proof of the anti-scientific nature of virology, but plays no role in the argumentation presented here. It is evident from points 1. and 2. that no genetic strand of a virus was ever found. Instead, existing fragments of nucleic acids were first multiplied biochemically, by means of double PCR, strongly and with an extremely high error rate. The sequences of these millionfold artificially generated nucleic acids were determined, subsequently subdivided mathematically into even much shorter sequences, and these were arbitrarily combined with each other. From the multitude of these arbitrary combination products, special software programs are used to select those that match a nucleic acid once it has been specified. The resulting mathematical construct is output as the genetic strand of a virus. So basically what Lanka claims is that the raw reads that are produced by the sequencing hardware correspond to real genetic sequences which exist in physical reality, but he claims that the source of the sequences are contaminants and not viruses. And he claims that when the raw reads are assembled to form a whole-genome sequence, it ends up reproducing the alleged genome of SARS 2 because during the alignment step of the assembly process, the reference genome of SARS 2 is employed as a template against which the raw reads are aligned. However you can look up the raw reads for a SARS 2 sequencing run yourself. For example go to the "Data availability" section at the end of this paper: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7409862/. Click on "SRR12109250" under "Data availability", click on "SRR12109250" again, click on "Reads", and copy the nucleotide sequence of the first raw read: `gttgtacttc gttcagttac gtattgctaa ggttaagact actctgcctt tgaacagcac cttcatcaga ttcagcttgc atggcattgt tagtagcctt atttaaggct cacctcagct tacctcctca tgtttaaggt aaacgatggc tgcattaacc actgttggtt ttaccttttt agcttcttcc acaatgtctg catttttaat gtatgcattg tcattagttt taataaccac cactaaaact attcacttta atgaat`. Then paste the sequence to the "Enter Query Sequence" field in nucleotide BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn. Then when you click the "BLAST" button, you'll see that the best match for the sequence is a genome of SARS 2, with around 90.24% identity which is within the typical error rate for nanopore sequencing. So if the sequence of the raw read actually comes from a contaminant like cow blood like Lanka claims, then why is the genome of the contaminant not the top match for the raw read? The GenBank database is full of the genetic sequences of contaminants. And if the genome of SARS 2 is just made up like Lanka claims, then why can you find a 266-nucleotide sequence in nature which is 90% identical to a segment of the genome of SARS 2? Lanka makes it seem like the process of assembling the raw reads involves some kind of black magic, but actually the assembly pipeline employs the same command line utilities that are used to assemble the genomes of humans and other organisms. One assembly pipeline that was designed for SARS 2 is called HaVoC, and it uses BWA or Bowtie to align the raw reads, Sambamba or Samtools to process SAM and BAM files, BEDtools to mask low coverage regions, Lofreq to do variant calling, and BCFtools or Samtools to perform consensus calling. [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8285700/] The same programs like BWA and Samtools are also used to assemble human genomes. [https://wikis.utexas.edu/display/CoreNGSTools/The+Basic+Alignment+Workflow] You can also try to assemble the raw reads yourself. Go to the "Data availability" section at the end of this paper: https://ncbi.nlm.nih.gov/pmc/articles/PMC7409862/. Click on "SRR12109250" under "Data availability", click on "SRR12109250" again, click on "FASTA/FASTQ Download". Then open this online utility for assembling the raw reads: https://ngdc.cncb.ac.cn/ncov/online/tool/variation?lang=en. Press the "Choose File" button next to "Upload Single-end Sequencing file", select the file you just downloaded, and press the "Run" button. Then after a few minutes you'll get the assembled genome, and it also shows you all of the bases where the assembled genome differs from the reference genome. The default reference genome used by the online utility is Wuhan-Hu-1, which is supposed to have been collected in December 2019. But yet the online utility detects that the raw reads you uploaded have the D614G mutation at position 23403, which only became common in March 2020. [https://ncbi.nlm.nih.gov/pmc/articles/PMC7310631/] So if the D614G mutation is not part of the Wuhan-Hu-1 reference genome, then where does the information about the mutation come from? Is the sequencing hardware rigged (so that the mutation is already present in the FASTQ file) or is the assembly software rigged (so that the mutation is not present in the FASTQ file)? If the sequencing hardware is rigged, then does the hardware look up information from some online database so that for example it should begin to introduce the D614G mutation to the raw reads around March 2020, and then later it should keep introducing the D614G mutation less often in Asia but more often in Europe? Would different sequencers by different manufacturers all be rigged the same way, and would even old sequencers which were manufactured before COVID be rigged? Would the sequencers also have similarly rigged logic for thousands or millions of other species of viruses so that for each virus, the sequencer somehow knows how to introduce the mutations which are supposed to currently be common at the current part of the world? How would the sequencer even know that a raw read is supposed to represent a part of the genome of a virus? Often the raw reads have an accuracy of only around 80% or 90%, and the sequencer would need to loop through the genomes of thousands of viruses to see if any of them matches the raw read with a high enough accuracy so that new mutations should be introduced to that region of the virus. But often there's millions of raw reads per run, so it would take forever to check each of them against each species of virus. Or alternatively, is the rigging done on the level of the command line programs that are used to do assemble the raw reads into a complete genome? Do the command line utilities look up information from some online database so that they know which mutations they should introduce to the virus depending on which mutations are supposed to be common at the current time in the current geographic area? You can see that's not the case if you look up the source code of the utilities. [https://github.com/lh3/bwa, https://github.com/samtools] And the utilities don't even require an internet connection to run. If you think that my method of doing a BLAST search for a raw read is not valid in the case of viruses, then you can also try my method with some other organism. For example when I searched the sequence read archive for "oxford nanopore wgs dog", I found a set of raw reads titled "WGS of Canis lupus familiaris: male yellow Labrador retriever". [https://www.ncbi.nlm.nih.gov/sra/SRX8367779%5baccn%5d] The set of raw reads was sequenced using the GridION sequencer by Oxford Nanopore Technologies which is also commonly used to sequence genomes of SARS 2. Then I clicked on "SRR11816795", I clicked on "Reads", I copied the sequence of the first read, I googled for "nucleotide BLAST" and opened the first result, I pasted the sequence into the big text field at the top, and I pressed the "BLAST" button. Then the best match for the BLAST search ended up being a sequence titled "Canis lupus familiaris breed Labrador retriever chromosome 37a". So if the raw reads produced by the GridION sequencer are valid in the case of Labrador retrievers, then why are they not valid in the case of SARS 2? On NextStrain, you can see how different mutations have been introduced to the genome of SARS 2 over time, and how different mutations are common in different parts of the world. [https://nextstrain.org/ncov] However the mutations are not part of the Wuhan-Hu-1 reference genome which is typically used to align the raw reads, so where does the information about the mutations come from?

## Chromosome 8 bombshell

In August 2020, Amandha Vollmer posted a video titled "Bombshell Evidence that COVID is Chromosome 8 Human DNA - Faulty PCR Test". [https://yummy.doctor/video-list/bombshell-evidence-that-covid-is-chromosome-8-human-dna-faulty-pcr-test/] In the video, she discussed a blog post from April 2020 which pointed out that in an RT-PCR assay developed by the Institut Pasteur in Paris, the 18-base sequence of one of the three reverse primers was identical to an 18-base segment within the human chromosome 8, which was supposed to show that the RT-PCR test would result in false positives because it matches human DNA. [https://pieceofmindful.com/2020/04/06/bombshell-who-coronavirus-pcr-test-primer-sequence-is-found-in-all-human-dna/] The blog post had earlier gone mostly unnoticed, but after Vollmer's video, the story about the reverse primer was picked up by Andrew Kaufman, Tom Cowan, and David Icke. [https://www.integralworld.net/visser183.html] In January 2020, the WHO published a PDF file about RT-PCR assays which were used to test for SARS 2, which included the assay developed by Institut Pasteur and six other assays. [https://www.who.int/docs/default-source/coronaviruse/whoinhouseassays.pdf] The assay by Institut Pasteur consists of three primer sets which target different regions of the genome of SARS 2, where each primer set consists of a forward primer, a reverse primer, and a fluorescent probe. The RT-PCR test doesn't produce copies of the entire genome of SARS 2 but only a few short segments of the genome, where each segment corresponds to a primer set. The forward primer marks the beginning of the region that gets copied, the reverse primer marks the end of the region that gets copied, and the fluorescent probe between the two primers is what is actually detected by the test. In the assay by Institut Pasteur, the length of the segments copied by the three primer sets were 108, 107, and 125 base pairs. If there's only a match for the forward primer but not the reverse primer, then the RT-PCR test won't make enough copies for the probe to be detected. The forward primer also needs to be located fairly close to the reverse primer. And furthermore it's not enough that there's a match for both of the primers, but the fluorescent probe between the primers also needs to match. And it is not enough that there's a match for the probe in only one primer set, but the probes in the other primer sets also need to match. It's explained in more detail in two YouTube videos that were posted by someone with the username Mark. [https://www.youtube.com/watch?v=O2TTKM1NWDA, https://www.youtube.com/watch?v=qOhqy-cxL0Y] In the primer set developed by Institut Pasteur where the reverse primer matches a part of human chromosome 8, the forward primer is `atgagcttagtcctgttg` (which is located at position 12690 to 12707 in the Wuhan-Hu-1 reference genome), the probe is `agatgtcttgtgctgccggta` (which is located at position 12717 to 12737 in Wuhan-Hu-1), and the reverse primer is `ctccctttgttgtgttgt` (whose reverse complement is `acaacacaacaaagggag` which is located at position 12780 to 12797 in Wuhan-Hu-1). Here's positions 12671 to 12810 in the Wuhan-Hu-1 reference genome with the primers and probe marked: `gctgtcaaat tacagaata[forward primer: a tgagcttagt cctgttg]cac tacgac[probe: agat gtcttgtgct gccggta]cta cacaaactgc ttgcactgat gacaatgcgt tagcttact[reverse complement of reverse primer: a caacacaaca aagggag]gta ggtttgtact`. [https://www.ncbi.nlm.nih.gov/nuccore/1798174254] The length of the human genome is about 3.1 billion bases, and the reverse primer is 18 bases long. Neither is random, but the likelihood that a random 18-base sequence is contained within a random sequence of 3.1 billion bases would be `(3100000000-17)/(4^18)`, or about 5%, and you can double the likelihood because the match can be on either strand.

## Use of smallpox vaccines as a biowarfare agent in the 1860s

According to conventional virology, smallpox is caused by the variola virus which is a member of the orthopoxvirus family. But if viruses don't exist, then it cannot be possible that when Europeans invaded America, they employed smallpox as a biological warfare agent to genocide Americans, unless you argue that smallpox is caused by a pathogenic agent which is not a virus. But since the agent existed hundreds of years ago, it is not likely to be anything like a product of synthetic biology or nanotechnology. So is the agent bacterial? In the book _Murder by Decree_, Kevin Annett quoted a book by Tom Swanky which presented evidence that smallpox vaccines were used to kill native Canadians in the 1860s: [http://murderbydecree.com] > In the fall of 2008, Tom Swanky, a former librarian in Quesnel, British Columbia released archival material he had research for over a decade concerning the earliest years of European occupation of the province. The material was entitled "The Tragedy of British Columbia: Genocide at its Founding". It relied on period newspapers and government correspondence to show that the leading politicians, traders, church officials, doctors and military men of the first colony on Canada's west coast actively killed off large sectors of the indigenous population. > Swanky's exhaustive study shows that this killing occurred primarily through the deliberate spreading of smallpox to Indians in targeted territories desired by white settlers, by the use of infected blankets and smallpox inoculations. He also demonstrates that a common element linking all of the chief conspirators in this domestic germ warfare is that they were all members of the Anglican Church of England and the colonial government, and were all shareholders in the Hudson's Bay Company and its subsidiary, the Puget Sound Agricultural Company (PSAC), which hungered for aboriginal lands. > Swanky begins by showing how the largest Indian war in Canada after the Riel Rebellion - the Chilcotin War of 1862-1868 - was an attempt by the Chilcotin (Tsilhqot'in) Indians to halt the men who were disseminating smallpox among their people. These men included Rev. John Sheepshanks, an Anglican missionary and a key actor in the germ warfare that would exterminate over 90% of the Chilcotins in a few years. For Sheepshanks almost singlehandedly inoculated the Chilcotin villages around the present day city of Quesnel and devastated this populace. > Across British Columbia, the pattern of this germ warfare remained the same: the highest concentration of Indian deaths from smallpox followed on the heels of their inoculation by Sheepshanks and others, and after the very men disseminating the disease had applied for "preemption" of the lands occupied by the Indians being inoculated well before they were killed off by the disease. (Normally, land could only be pre-empted if they contained no inhabitants.) > For example, on the central coastline near Bella Coola during 1861 and 1862, over three quarters of the several thousand Indians were dead from smallpox after being inoculated by Anglican missionaries; 1500 had died in just a four week period. Just before their annihilation, the Attorney General for the province, George Carey - a long time trading partner with the PSAC - had stated in the legislative Assembly "There is no settlement in Bella Coola, nor shall there be." > Several of Carey's business partners - John and Robert Miles and Duncan MacKay, all PSAC shareholders - had during 1860 applied for pre-empted lots of 160 acres each on the land still occupied by the Bella Coola Indians: nearly a year before the smallpox wiped out most of them. Obviously, these unlawful pre-emptions occurred in the knowledge that there would soon be no Bella Coolas on the land. > In his memoirs, Francis Poole - an officer in the Royal Engineers and a business partner of George Carey - wrote, "I led the party that introduced smallpox in Bella Coola and Fort Alexander ..." William Downey, another PSAC partner, wrote in 1893, "In the year 1862, smallpox was carried by whites into Bella Coola." > During the same period, Rev. John Sheepshanks conducted the same genocidal operation in the central interior. Early in 1862, another Royal Engineer, Colonel Moody of New Westminster (then the provincial capital) ordered Lt. Henry Palmer to go among the populous Chilcotin Indians and "lay out reserves for several new town sites." Moody - a PSAC investor - then put his friend John Sheepshanks - who served as chaplain to the Royal Engineers - in touch with a Dr. Seddall, who provided the missionary with smallpox inoculations. Sheepshanks then joined up with Lt. Palmer. > According to the Colombian newspaper of April 29, 1863, > > The good missionary Reverend Sheepshanks stated at a public meeting that during his tour of the Interior during July of last year, he had vaccinated all the Indians he could find. > Within two months of Sheepshanks' mass inoculation of the Chilcotins, nearly all of them were dead or dying from smallpox. In what is now the town of Quesnel, his partner Lt. Palmer had already preempted most of the Chilcotins' land on behalf of Col. Moody and his business associates. > John Sheepshanks was rewarded for his murder of so many Indians by his eventual appointment as Bishop of Norwich and a seat in the House of Lords in London, which he held until his death in 1908. In his memoirs, Sheepshanks remarked ominously, > > The noble savage is being improved off the face of the earth ... I cannot now dwell upon the causes of the disappearance of these people, though alas! Some of them I know right well. > John McLain, one of Sheepshank's associates also commented much after the fact, when recalling his sojourn among the Chilcotins as a land speculator, "I got a blanket well-infected with smallpox, carefully put it between a saddle blanket and a sweat pad ... I succeeded. They all died of smallpox." (From his memoir _Only in Nazko_, 1908) > At exactly the same time, a third area of British Columbia was experiencing the same germ warfare. William Manson, a factor with the Hudson's Bay Company in Kamloops, kept an official journal in which he noted the following incidents as he disseminated smallpox: > > June 24, 1862: Vaccinated many Indians of the North River > > July 12: Smallpox raging among the North River Indians > > July 29: Vaccinated South Branch Indians > > August 2: Indians begin dying along the south branch > > August 18: Indians refuse contact and further vaccinations > > September 28: Smallpox is raging among all the Indian bands > By October of 1862, smallpox had devastated Indian tribes in a huge arc encompassing the west coast, northern and central Interior villages. In the Chilcotin area alone, over 5000 Indians had died of the disease in less than six months, while only four whites had died from it: for only the Indians had been inoculated. > Significantly, this arc of mass death corresponded exactly to the path of travel of smallpox disseminators like Sheepshanks, John Poole of the Royal Engineers and Alex MacDonald of PSAC. In fact, over 90% of all interior Indians died during this brief period, and all of their land had been previously pre-empted by Sheepshanks' business partners in PSAC. > Nearly all of the senior government officers in British Columbia at this time were company shareholders, including Governor Douglas, Speaker of the Assembly Dr. John Helmcken, Chief Justice Cameron and thirteen Members of the Legislature. All of these men were loyal Anglicans. In the book _The Truth About Contagion_, Tom Cowan and Sally Fallon Morrell presented the hypothesis that smallpox is caused by bedbugs: [https://books.google.com/books?id=94kfEAAAQBAJ&pg=PT62] > Dr. Charles A. R. Campbell of San Antonio, Texas, believed that smallpox was transmitted by the bites of bedbugs. > [...] > Dr. Campbell ran a "pest house" for smallpox patients in San Antonio, where he tried hard to infect himself and others by "fomites" and direct face-to-face contact with infected persons: > > As even the air itself, without contact, is considered sufficient to convey this disease, and touching the clothes of a smallpox patient considered equivalent to contract it, I exposed myself with the same impunity as my pest-house keeper. ... After numerous exposures, made in the ordinary manner, by going from house to house where the disease was ... I have never conveyed this disease to my family, or to any of my patients or friends, although I did not disinfect myself or my clothes, nor take any precautions whatever, except to be sure that no bedbugs got about my clothing. > > Another one of my experiments was thoroughly to beat a rug in a room, only eight or ten feet square, from which had just been removed a smallpox patient. ... I beat this rug in the room until the air was stifling, and remained therin for thirty minutes. This represented the respiratory as well as the digestive systems as accepted avenues of infection. ... After inhaling the dust from that rug, I examined my sputum microscopically the following morning and found cotton and woolen fibres, pollen and comminuted manure, and also bacteria of many kinds.[25] > Although Dr. Campbell subsequently mingled with family, patients, and friends, none contracted smallpox. He repeated these experiments with others, failing to infect, even when in contact with patients covered in sores, but he always found bedbugs in the houses of those who contracted the disease.[26] > The British and American colonists used smallpox as a weapon against the Native Americans - they did it by giving them blankets, thus spreading the bedbug to the New World. The bedbug hypothesis doesn't explain why Reverend Sheepshanks was able to use vaccines to infect native Canadians with smallpox. Even though I guess you might argue that Sheepshanks employed other means of spreading smallpox in parallel with the vaccinations, or that the vaccines contained the remains of bedbugs or that the vaccines contained the disease-causing agent extracted from bedbugs. But then if the disease-causing agent in the bedbugs is not a virus, then is it bacterial? And then wouldn't the bacteria be well-characterized by now since they cause such an important disease? Smallpox has a distinct visual presentation as a disease, so even in the 1800s, it was easy for people to visually diagnose smallpox and to tell which people died of smallpox. So people like Sheepshanks and Manson were able to tell that the people they vaccinated died of smallpox and not some other disease. In his diary, William Manson wrote that on July 29th, he "vaccinated South Branch Indians", and that four days later on August 2nd "indians begin dying along the south branch". So did he vaccinate them with some kind of a slow-acting poison that caused smallpox-like symptoms and that resulted in death a few days later? Or did he actually vaccinate them with smallpox?

## Twitter thread by Kevin McKernan

The following is a Twitter thread by McKernan from 2020 reformatted as plain text: [https://twitter.com/Kevin_McKernan/status/1344683958613782528] > 1. OK Koch heads... bring your hurt. I'm glad you folks exist as we need people questioning everything. However, I have found the "virus doesn't exist" arguments unconvincing. The virus isn't the only cause of disease may have some ground. I remain open to new papers on this. > 2. Set some rules. This was established in 1884. Watson & Crick discovered DNA structure in 1953. He did not contemplate unculturable organisms... the vast majority of organisms are not culturable. Viruses by definition cannot be cultured. They require a host cell to culture. > 3. This is where the debate gets dirty. In order to culture the virus you need to find cells/organisms it can infect but not be a pathogen to those cells. But Koch wants to demonstrate the pathogen creates symptoms of the disease which be counterproductive to culture. > 4. This is like the uncertainty principle. The cell line/model organism you choose to culture the virus, can't be extremely affected by the virus or the culture won't succeed. Therefore the vector for the disease is unlikely to be the best place to look for the disease symptoms. > 5. As a result we have folks discounting Vero cell (monkey kidney cells) studies for viral isolation. By this same logic, all animal models are thus insufficient as well. Any argument that Vero cells are not identical to patients must also reject all animal models. > 6. Medical ethics prevents us from infecting real patients with a virus suspected of pandemic potential. This leaves us with ex-vivo culture of sick and healthy patients samples. Fairly invasive research. Needs IRB approval. https://thelancet.com/journals/lanres/article/PIIS2213-2600%2820%2930193-4/fulltext > 7. This [referring to the image in the tweet] extracts epithelial cells from patients respiratory tract and cultures those cells as a model for viral infection and replication. It has been done in C19 and I'm open to Koch folks scrutinizing its shortcomings. > 8. Ideally, we would have highly purified virus from the diseased and be able to put it into a human cell line and demonstrate replication and illness and re-isolate and confirm its the same. Since we can't infect humans, we resort to human cell lines. > 9. We have new tools for understanding purity today. We can sequence all RNA in a patient and see the complete virome present. Based on the sequence we can predict proteins we should see with mass spec after successful viral replication in a host. https://biorxiv.org/content/10.1101/2020.04.20.048066v5 > 10. Mason's lab goes on to build beautiful whole transcriptome pictures of each SARS patient. Over 96% of the patients had C19 sequence in their bronchial lavage (BAFL). This is not Vero cell culture. Patient cells. Whole SARS genomes from patients and it's the dominant RNA present. > 11. Some will say... you don't know it's the causative virus from this. Highest prevalence does not equal causative agent. But since we have whole transcriptomes we can see there is no other sensible hypothesis. No other viruses present. The RNA has been isolated but not the virus. > 12. On the flip side, images of fuzzy crowns on EM, I find unconvincing. You can't identify a virus with a photograph. All taxonomy is ultimately DNA/RNA based. So how do we catch the virus in the act of infection? Spatial transcriptomics - this is the art of sequencing in situ. > 13. You infect cells with the purified virus and you perform spatial transcriptomics on those cells. This is a new, explosive and exciting field that SOLiD sequencing is still being used for. https://www.science.org/content/webinar/mining-transcriptome-using-spatial-transcriptomics-comprehensive-2d-3d-visualization-all-mrnas-tissue-sections > 14. It's worth understanding the technique. It enables you to harvest RNA from cells and maintain their spatial coordinates in the cell with 10um and eventually 1um resolution. It's unlikely to get below the diffraction limit of light (250nm) in terms of resolution. > 15. Here it deployed on C19 patient biopsies. We have spike protein histochemistry co-localized with C19 RNA sequence in infected patients. Not all biopsies succeeded. Lots of tissue heterogeneity but a good piece of the puzzle. https://medrxiv.org/content/10.1101/2020.11.04.20225557v1.full.pdf > 16. Now many are of the opinion that we need purified virus particle for the story to be complete. I think this statement is stuck in 1884. Viruses evolved from viroids. Viroids are just RNA. No capsid. Small RNA alone can infect cells. https://apsjournals.apsnet.org/doi/full/10.1094/PDIS-03-19-0530-PDN > 17. So we have to keep our eyes on the code of the disease, not its wrapper. The code dictates its proteins and identity. The wrapper is a non-specific, low information content camouflage that provides nice eye candy for journalists but provides little signature for function or ID. > 18. So when people say, "you haven't purified it". You can't claim A causes B because you can't assure me A is only A. This is misunderstanding what whole transcriptomes do. When you sequence everything, you can then choose to synthesize the single RNA you think is causative. > 19. This is as pure as you can get. Even more pure than a cesium gradient isolation of the particles as the biological isolation will have biological contaminants not found in a synthesized from scratch genome. We can also test the hypothesis. Knock out a gene and see what happens > 20. 4,000 times in one study. But this won't be pure enough for the Koch crowd. https://pubmed.ncbi.nlm.nih.gov/34792434/ [link to a paper titled "Isolation of 4000 SARS-CoV-2 shows that contagiousness is associated with viral load, not vaccine or symptomatic status"] McKernan also presented arguments against the no-virus people in an interview that he did with Yohan Tengra in 2021. [https://www.bitchute.com/video/fnXOI6h6EOLI/, starts at 1:04:10] In one Substack post McKernan wrote the following: [https://anandamide.substack.com/p/obelisks-and-viroids-kryptonite-for] > Why is this kryptonite? > Because you chemically synthesize 256bp circular viroids from scratch. > 99.9% pure. No isolation from other biological sources that might have evil humors or 'water terrain memory' responsible for the cytotoxic effects. > You can inject this circular RNA into cannabis plants and witness it replicate throughout the plant. > You can measure the circular to linear RNA ratio change once in a plant cell with RNase R. > You monitor it in the roots, leaves and pollen. > Even the insects which feed on the plant (leaf hoppers) become PCR positive. > And it transmits in seeds and mechanically. > I know this because I have performed all of these steps myself and mirrors what others have found. > 'But PCR is modeling!, Kary Mullis, 97% FP, Late CT... blah blah blah". All of this irrelevant with cloned plants where quarantine isn't controversial. > It's not modeling for cannabis grows which have the highest agricultural overhead of any crop. > 4% of the power grid in Denver CO is feeding cannabis lights as it has to be grown indoor in a video surveilled prison where every plant is RFID tagged and traced. 1300ppm CO2 is pumped in with sophisticated fertigation systems and HVAC monitoring. > As a result of this overhead, no grow wants a viroid that reduce crop yield 40%. > As a result, they RT-qPCR screen their cloning operation and the savings more than pay for the qPCR. > At some point, voluntary economics explains who is right and who is just angry. > Kochs postulates has been proven with hop latent viroid and cannabis.

## PDF by CDC which said that no quantified virus isolates are available

A PDF published by the CDC in February 2020 said: "The analytical sensitivity of the rRT-PCR assays contained in the CDC 2019 Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel were determined in Limit of Detection studies. Since no quantified virus isolates of the 2019-nCoV are currently available, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession: MN908947.2) of known titer (RNA copies/μL) spiked into a diluent consisting of a suspension of human A549 cells and viral transport medium (VTM) to mimic clinical specimen." [http://web.archive.org/web/20200205171727/https://www.fda.gov/media/134922/download] The PDF was later changed to say "no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed and this study conducted". [https://www.fda.gov/media/134922/download] The term 2019-nCoV fell out of use after the term SARS-CoV-2 was introduced on February 11th. When I searched Twitter for `from:cdcgov "2019-ncov"`, the newest tweet it returned was from February 11th 2020 UTC. [https://twitter.com/search?q=from:cdcgov+%222019-ncov%22&f=live] By "quantified virus isolates", they may have meant samples of the virus which would've been normalized for the number of copies of the virus that were included in each sample. So it doesn't necessarily imply that no kinds of isolates were available or that the virus had not been isolated: [https://www.reuters.com/article/uk-factcheck-cdc-idUSKBN27633R] > Dr Thushan de Silva, from the University of Sheffield's Department of Infection, Immunity and Cardiovascular Disease, told Reuters that this was not correct. > De Silva said that the document is describing what was used to determine the lowest amount of viral genetic material the RT-PCR assay could detect. > "They describe a very common process during assay set up, where the limit of detection of the RT-PCR assay was determined", he said. > In this case, the CDC have used 'transcribed' RNA as the positive control - which means they used synthetically produced genetic material identical to that carried by the virus. > "To calculate the limit of detection of an RT-PCR assay, you need to have a known quantity of virus to extract genetic material (RNA) from, or alternatively a known quantity of RNA identical to that carried by the virus", de Silva said. > According to de Silva, one reason for using transcribed RNA would have been that at the time of set up, not many standardised and quantified viral stocks would have been available to extract viral RNA from.

## Kary Mullis on PCR

In the patent for PCR that was issued in 1986 to Kary Mullis et al., they wrote that one application for PCR would be to diagnose the presence of pathogenic microorganisms including viruses: [https://patents.google.com/patent/US4683195] > Various infectious diseases can be diagnosed by the presence in clinical samples of specific DNA sequences characteristic of the causative microorganism. These include bacteria, such as Salmonella, Chlamydia, and Neisseria; viruses, such as the hepatitis viruses; and parasites, such as the Plasmodium responsible for malaria. U.S. Pat. No. 4,358,535 issued to Falkow describes the use of specific DNA hybridization probes for the diagnosis of infectious diseases. A problem inherent in the Falkow procedure is that a relatively small number of pathogenic organisms may be present in a clinical sample from an infected patient and the DNA extracted from these may constitute only a very small fraction of the total DNA in the sample. Specific amplification of suspected sequences prior to immobilization and hybridization detection of the DNA samples could greatly improve the sensitivity and specificity of these procedures. Mullis was also the last author of a patent from 1989 titled "Detection of viruses by amplification and hybridization", where they specifically wrote that PCR can be used to detect HIV, and they wrote that HIV has been sequenced and that there are isolates of HIV available: [https://patents.google.com/patent/US5176995A] > The term "virus" as used herein refers to any isolate for series of related isolates that have a sequence that is substantially conserved among and specific to the nucleic acids in the virus(es). Examples of such viruses include HIV, hepatitis B virus, herpes viruses, hepatitis A virus, rhinovirus, papilloma virus, Epstein-Barr virus, etc. Preferred viruses herein are AIDS and hepatitis B. > The present invention relates to a process and kit for detecting or monitoring for a nucleic acid sequence associated with a virus in a sample of nucleic acid(s) suspected of containing the sequence. The following discussion relates to the HIV and hepatitis B virus in particular, but could be applied to any virus as defined herein. > Because HIV is highly variable, there is a need to find a common denominator (conserved region with a length which allows a specific primer as defined herein to initiate polymerization) among the variants of the virus to use for detecting a significant fraction of the viruses associated with AIDS. A significant fraction is that number of individuals sufficient to make the test diagnostically or commercially feasible. Currently four HIVs, ARV, HTLVIII, LAV and LAVA, have been sequenced, and five human hepatitis B viruses as well as related viruses that infect woodchucks, ground squirrels and ducks, have been sequenced. Kary Mullis was additionally one of the authors of a paper published in 1987 titled "Identification of Human Immunodeficiency Virus Sequences by Using In Vitro Enzymatic Amplification and Oligomer Cleavage Detection". [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC254157/pdf/jvirol00096-0400.pdf] When Kary Mullis said that "quantitative PCR is an oxymoron", I believe he meant that PCR was not an accurate way to quantify viral load, and not that PCR was not an accurate way to determine whether a sample contains a virus or not. John Lauritsen wrote: "With regard to the viral load tests, which attempt to use PCR for counting viruses, Mullis has stated: 'Quantitative PCR is an oxymoron.' PCR is intended to identify substances qualitatively, but by its very nature is unsuited for estimating numbers." [https://www.virusmyth.com/aids/hiv/jlprotease.htm] According to Rod Knoll, Mullis said that "quantitative PCR is an oxymoron" during a speech in 1994 but there is no recording or transcript available of the speech. [https://dpl003.substack.com/p/a-review-of-mullis-by-rod-knoll] In an interview with Gary Null, Mullis also said: "PCR came along right about the same time that HIV did. And it was in that [unintelligible word] that people started looking with PCR for HIV. That was the only way to see it, except for culture. Which was a long protracted procedure, which a lot of times didn't turn right. [...] The culture - the whole method - cell biology is a bunch of magic half of the time. And people who say that they can do quantitative estimations of HIV from culture, they're just - they're fooling themselves." [https://www.bitchute.com/video/8SjzUDxBZL9t/, time 9:05] But by "quantitative estimations", I think Mullis was again talking about estimating viral load. And I don't know why he was talking about cell culture, because you don't have to do cell culture if you're using PCR to detect HIV. HIV is typically detected using antigen or antibody tests and not PCR, but the main use of PCR tests in the case of HIV was traditionally to measure viral load. PCR tests for HIV are commonly called "NAT tests" or nucleic acid tests, and they are further divided into quantitative and non-quantitative NAT tests depending on whether their aim is to measure viral load, even though some NAT tests for HIV also use transcription-mediated amplification instead of PCR. So the typical use of PCR tests for HIV is different from the typical use of PCR tests for COVID. The CDC's website says that "Most rapid tests and the only HIV self-test approved by the U.S. Food and Drug Administration (FDA) are antibody tests." [https://www.cdc.gov/hiv/basics/hiv-testing/test-types.html] And the CDC's website also says that a NAT test "can tell if a person has HIV or how much virus is present in the blood (HIV viral load test)" and that a NAT test "should be considered for people who have had a recent exposure or a possible exposure and have early symptoms of HIV and who have tested negative with an antibody or antigen/antibody test" (so basically a NAT test is used either to measure viral load or as a fallback for antibody and antigen tests). In the year 2006 in Australia, there was a court case where someone was convicted of three counts of endangering life after he had unprotected sex with three women without telling them that he was HIV positive. [https://web.archive.org/web/20070709210442/http://garlan.org/Cases/Parenzee/2007-SASC-143-Parenzee.pdf] He appealed by stating that HIV has not been proven to exist, and testimony in his favor was provided by Eleni Papadopolous-Eleopulos and Valendar Turner from the Perth Group. After Mullis's comments about PCR were brought up by the Perth Group, Mullis was sent an e-mail which said: "I am assisting the prosecution in an Appeal to the Supreme court in South Australia about a conviction for criminal transmission of HIV. The basis for that Appeal is that HIV does not exist and that the PCR technology is flawed. So in effect the technical basis for identification of virus is on trial. The group of denialists giving evidence are people from Perth who quote you as indicating that PCR technology is erroneous and misleading. Can I ask you to comment on this statement." [http://aras.ab.ca/articles/legal/McDonald-Mullis.html] But the response by Mullis said: "I will not try to convince anyone that PCR can be used successfully to specifically make multiple copies of any nucleic acid sequence that can be uniquely defined by two 'primer target sequences' comprising the termini of the sequence of interest. The veracity of this no longer has anything to do with me. I think this has been confirmed by a huge number of laboratories around the world. The rapid spread of this simple technology would not have occurred had it been ineffectual or flawed in any persistent way." And Mullis also wrote that "the AIDS/HIV issue is what is not settled scientifically, not the effectiveness of PCR". The court documents described Mullis's comments like this: [https://web.archive.org/web/20070709210442/http://garlan.org/Cases/Parenzee/2007-SASC-143-Parenzee.pdf] > Ms Papadopulos-Eleopulos had said that the inventor of PCR was purported to have expressed a lack of confidence in PCR. Professor Mullis received a Nobel Prize in Chemistry for having invented the PCR technique. As a consequence of the reference to Professor Mullis, Professor McDonald made contact with him. > Professor McDonald said the effect of Professor Mullis' answer was to express confidence in the PCR system. Professor McDonald said that the controversy around HIV is not a controversy around whether PCR is a valid technology or technique. Professor Mullis had stated in a paper titled "A hypothetical disease of the immune system that may bear some relation to the Acquired Immunodeficiency Syndrome"[155] that there was a controversy as to whether and how HIV caused AIDS. The PDF linked above also said: > At the trial, the three complainants gave detailed evidence of their sexual contact with the applicant. Ms C, who has been diagnosed with the virus, gave evidence that her only sexual contact during the relevant time before she was diagnosed as HIV positive, was with the applicant. > When the strain of HIV, for which she had tested positive, was compared with the tests from the applicant, the genetic sequence of her HIV positive test had a variance of about 1% from the sequence of the applicant. There was evidence at trial that of all the virus profiles on the database of the SA Institute of Medical and Veterinary Science, the closest profile to that of the applicant was that of Ms C. The closest unrelated sequence to either the applicant or Ms C had a variance of about 4%.

## Study where human volunteers were infected with SARS2

In a paper published in 2022 titled "Safety, tolerability and viral kinetics during SARS-CoV-2 human challenge in young adults", human volunteers were infected with SARS-CoV-2: [https://www.nature.com/articles/s41591-022-01780-9] > To establish a novel SARS-CoV-2 human challenge model that enables controlled investigation of pathogenesis, correlates of protection and efficacy testing of forthcoming interventions, 36 volunteers aged 18-29 years without evidence of previous infection or vaccination were inoculated with 10 TCID50 of a wild-type virus (SARS-CoV-2/human/GBR/484861/2020) intranasally in an open-label, non-randomized study (ClinicalTrials.gov identifier NCT04865237; funder, UK Vaccine Taskforce). After inoculation, participants were housed in a high-containment quarantine unit, with 24-hour close medical monitoring and full access to higher-level clinical care. The study's primary objective was to identify an inoculum dose that induced well-tolerated infection in more than 50% of participants, with secondary objectives to assess virus and symptom kinetics during infection. All pre-specified primary and secondary objectives were met. Two participants were excluded from the per-protocol analysis owing to seroconversion between screening and inoculation, identified post hoc. Eighteen (~53%) participants became infected, with viral load (VL) rising steeply and peaking at ~5 days after inoculation. Virus was first detected in the throat but rose to significantly higher levels in the nose, peaking at ~8.87 log10 copies per milliliter (median, 95% confidence interval (8.41, 9.53)). Viable virus was recoverable from the nose up to ~10 days after inoculation, on average. There were no serious adverse events. Mild-to-moderate symptoms were reported by 16 (89%) infected participants, beginning 2-4 days after inoculation, whereas two (11%) participants remained asymptomatic (no reportable symptoms). Anosmia or dysosmia developed more slowly in 15 (83%) participants. No quantitative correlation was noted between VL and symptoms, with high VLs present even in asymptomatic infection. All infected individuals developed serum spike-specific IgG and neutralizing antibodies. Results from lateral flow tests were strongly associated with viable virus, and modeling showed that twice-weekly rapid antigen tests could diagnose infection before 70-80% of viable virus had been generated.

## Comments by Philip J. Buckhaults in defense of PCR

Buckhaults verified McKernan's findings about DNA contamination in mRNA vaccines. He posted the following tweets about PCR: [https://x.com/P_J_Buckhaults/status/1709931650862494007] > we now design our primers and probes such that a negative sample stays negative even if cycled out to 60+ cycles. By using diluted positive controls, we know where single molecules fire (usually Ct- 35-40). So if its negative at 45, it will be negative at 145. > [...] > the definition of a test is something that is confirming suspicions. to be a screen, it should have a very low false positive rate. however, during the height of the pandemic, the pcr assay was adapted and used as a screen partly because the prevalence of infections (and thus true positives) was so high that prior enriching for true positives by requiring symptoms did not significantly decrease the low false positive rate. eventually as prevalence dropped, people stopped using it as a general screen in unselected people, but it was still very useful when monitoring a household with a known symptomatic positive. for my university, when there was no corroborating symptoms but only a low-level positive, it was routine to check again in the next one or two days to figure out if the person was on the front side or back side of the infection curve. it was pretty obvious with just one additional time point. the positivity that lasts for weeks after infection is very low and does not change with time. but an active clinical infection is low for less than one day and rapidly shoots up many orders of magnitude. there was a lot of additional information contained in the Ct values that was not usually conveyed to the patient but was useful nonetheless. in summary, the false positive rate of PCR did not create or inflate the pandemic. > [...] > depends on what you mean by clinical significance. a single molecule at Ct 37 can be clinically significant if you are at the beginning of the infection, as the viral load will be 1000 times higher (and Ct = 23) in 24 hrs. so it can predict the future. my test would decay back down to Ct 32/33 after 10 days, so Ct 32 or later for two consecutive days was usually clinically meaningless (but most people in this category isolated anyway just to be safe for others. Buckhaults also posted this tweet: [https://x.com/P_J_Buckhaults/status/1753807029171261538] > there was a real wave of the virus. I know because I detected it myself with a PCR test that I invented. And I saw it wave through large populations of people who got sick, and then who got better, and the virus quantity in their saliva track perfectly with their illness I know that part is true, because I saw it myself. One of those positive people I tracked over four separate infections every day. That person was me. and I did my own PCR on my own saliva, so there was nobody that could fool me on this and a couple of times I sequenced it so I know it’s real. In a discussion about whether the virus may have been circulating before late 2019, Buckhaults replied: "when I validated my PCR test, I checked hundreds of old samples and they were all negative." [https://x.com/P_J_Buckhaults/status/1757095152420618516] But people in other labs have probably similarly done PCR tests for old samples, and if they would've gotten positive results then they could've also sequenced the samples and it would've been huge news if they found earlier strains of SARS2.

## Twitter user ferryman

In a thread about early accounts that posted about flat earth, the Twitter user conspirator0 wrote: "How did the surge in #FlatEarth traffic begin? @ferryman and @Jayson4mind appear to be the first accounts to have pushed on-topic #FlatEarth tweets, in the form of spammy links to YouTube videos. Other accounts whose activity correlates with increases in volume are also shown." [https://twitter.com/conspirator0/status/1110349151802408960] In the same thread he also pointed out that ferryman's first tweet about flat earth was posted in April 2015, and it linked to a YouTube video by Mark Sargent from February 2015. [https://twitter.com/ferryman/status/583666715336306688] When I searched Twitter for `from:ferryman virus`, I found that the user had posted a tweet in 2018 which said this in Dutch: "I know this for sure because I have already discovered many lies of science. Atom has never been proven, virus never proven, evolution impossible, big bang impossible, moon landing 1 and all fake. Mars ditto. HIV nonsense. AIDS also lie. Etc etc". [https://twitter.com/search?q=from%3Aferryman%20virus&src=typed_query&f=live] He also posted this tweet in Dutch in 2018: "Virus -free island? Haha. It has never been proven (except on the computer) that viruses exist. #Newshour". And in 2019 ihe tweeted: "'Science' turns out to be one big scam every day. Search for the existence or a photo of an atom. You won't find any evidence. The existence of a virus ? Ditto. And there are many theories that are not facts." Since it's a popular theme among flat earthers to question various fields of science, it's not that surprising that flat earthers would've already questioned virology before 2020. These days there are probably many people who genuinely believe in flat earth and who genuinely believe that viruses do not exist. But in the first half of 2015 which was in the very early days of the flat earth movement, the movement had not yet gained a very large following of useful idiots, so a large percentage of people who posted about flat earth online were probably deliberately promoting false information. So it's suspicious that ferryman was one of the first Twitter users who started posting about flat earth, and that before COVID he was already saying that viruses do not exist.