Are the white clots found by embalmers a hoax? (part 2) - sars2.net

Other parts: clot.html, clot3.html (Kevin McCairn).

Contents

Are calamari clots made of spider silk protein coded by the Pfizer reverse ORF?

During an interview with Mary Holland from CHD, Ana Maria Mihalcea claimed that the calamari clots contained spider silk protein. She said: "Clifford Carnicom and I have got the deceased clots from Richard Hirschman, we got a clot from a living vaccine injured person, and from an unvaccinated individual. And what we looked at is clearly this rubber-like material that we know about. And we did by mircoscopy, and we found the same filaments that we see in the blood, absolutely the same stuff, okay. And then we did near-infrared spectroscopy and found that these things have a polyenes, which is polyethylene alcohol, polyvinyl alcohol, which is plastic, and polyamide, which is silk, nylon, or Kevlar. And specifically, you know, Kevin Kerningham, Dr. Kerningham [meant McKernan] found the genes of DNA of spidroins of spider silk. That's the strongest military-grade material that they have made. And so we found these in the clots." [https://x.com/ChildrensHD/status/1845970364993798325, time 41:40]

However McKernan did not actually find a spidroin protein in the Pfizer vaccine sequence, but "spidroin" was a nickname he gave for the long open reading frame he found on the reverse strand of the Pfizer sequence. When he searched for the reverse ORF on UniProt BLAST using extremely liberal settings, the closest match happened to be a protein that was annotated as a spidroin by chance, even though it was an extremely distant match that had only about 25% identity, and it wasn't returned as a hit when he ran regular BLAST with the default settings: [https://anandamide.substack.com/p/spider-webs-in-the-pfizer-closet]

The spidroin protein sequence was likely misannotated, and it was removed from UniProt in June 2024, so it is no longer even returned as a result if you do a BLAST match for the reverse ORF. But before it had been removed, I downloaded the Pfizer plasmid sequence that McKernan uploaded to GenBank, and I picked the longest ORF on the reverse strand:

$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=OR134577'>pfizerplasmid.fa
$ r=$(seqkit seq -rp pfizerplasmid.fa|seqkit seq -s);for x in $r ${r:1} ${r:2};do sed 's/.../& /g'<<<$x|grep -Po 'ATG.*?(?=(TAA|TAG|TGA))'|tr -d \ ;done|awk '{print">"NR}1'|seqkit translate|seqkit sort -lr|seqkit head -n1|seqkit seq -s
MQYQLESSCVVQFHALQHGLRIVLVELAAAATATTALQAATAAGHATQHDCDHHDGNQSGDKAQPDVPGPLDVLLVLPQFLQVDQALVQILGHLVQPVDLFLDVHDAGIDSADIAQVHVGACVVLKVLVQFLFEAVQLGLQRVVHGIVHNADHDVAVARHEGVVGGDDLGLVEVPLCHEPMGAVGHEHAFSRKVGFAVVADGWSGGEILLLSGHICHVQKHHAVRGRLREAHQVVALAAKVHSLALAQHTLRHLGGGQIGRGSNLGGSDQLLGHVCLEALQSACDQSVDLHLGLRRVQSAQDIVQHRADGAELGGQLLDQGVQCLGIVVDHVLQLSQGACCAAQAVLDLADGAVELVGDQLLVLVQHILGHSDAVEPVGHLHSKGDLQSGACSKCPAACDCAGQQGRCVLGDHLIGQQRRQHCQSVKLLGANQIPGGNVAQTIAILLDEAGVGQCHFVEQQVLDEAPLAGLARIGQNLAEIEAAEVLDRRGLVDLLHLGEHLLGVLVLFHGDPCQGSFQLGAEAAVLQQQVGALGGIAADVHGAVHAGLGHGHRQDLCGHADGEVGGDSDRVVGVGHAVLGAQRHCVGNDALAGHASGSPVALCLCLVAGADSSADGDVALVAIVHVLGSDQTAGSGLKHIAAGGVHPPCRCQLIGVNGHGHFGTVHALVQHCHLIAGVGARGDHRHSAEAARGDVQDFQCLGISNGVCGIGDIPAKLLEWQELLVALCQHAGAGQAVEVEVHAFVLHEIGAFLRAAHCGRGMQQFEAQHHHSVGLVAHAVCGPKAVGLQWEVAVHACHAVTRLVAGLIDLGGDVPLEGLQIGLPEQPVPVIVVAADFGVQLVAVPGNHTAGEVVGQLVVVVGDVACLSRGNLPHFVSPDHEAVGVHVCEAQVVQLGRGHAVALECEEGGEVVQHGVVGHAIADPLPVPGVHRGESGGIEHLVEGAQIGDIGEPHDGFGGLHPEVAGLVDALFHGEGLQGALCLAQRIQSTIHGVGDGAVLVVLQQEGSRLQVAHIVSGGTSCPSAAAIARCQVASVQGQQCLKPGDVDADGQIHQGFQSREALRQIPAEVDRGVLAVDLEVAVDVLKHELAQVLEVALLAFQVHQERLGHVLEGAVVGAAVHPELAFHPALVVLVVVDVQEGVVAELELAHFDDHVGGVVHDQQALGLAVQCGAEDPASDDVGLLGAGKVHPVVEGQHGVVESLGAIGAGDGVEPGHVAEERQEQVLGRVQHAGSEHLVGVVHASGKAVGV

Then I pasted the ORF here and clicked "Run BLAST": https://www.uniprot.org/blast. McKernan ran his BLAST search in late 2023, but I ran the search several months later when there had been more sequences added to the UniProt database. So now the spidroin protein only came on third place, but the best two matches were a protein from algae and a cockroach protein. But all of them had a poor match with only about 25% identity:

From the table above you can also see that the match to the misannotated spidroin protein has a length of 1,496 aa and about 24% identity, but the matches to the next 5 closest proteins have similar percentage identities around 25% and length around 500-4000 aa. The match to the spidroin has an E-value of about 1.3e-9, which is meant to indicate how many similarly close matches are expected to occur by chance. But in this case the E-value is clearly too low, which might be because the query sequence had an unusual distribution of amino acids because it was the reverse complement of a codon-optimized sequence, but the E-value was calculated using the BLOSUM62 substitution matrix which assumed a natural distribution of amino acids.

ChatGPT said:

3. Query Composition Bias

4. Scoring Matrix and Gap Penalties

5. Statistical Assumptions Violation

Both the misannotated spidroin protein and the reverse ORF do in fact have a high percentage of glycine:

# download MaSp1 sequence from UniProt, McKernan's Pfizer plasmid sequence, and coding sequences of SARS-CoV-2
curl 'https://rest.uniprot.org/unisave/G1Y380?format=fasta&versions=18'>spidroin.fa
curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=OR134577'>pfizerplasmid.fa
curl -s 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&rettype=fasta_cds_aa&id=MN908947.3'>sars2.aa

# find longest ORF on reverse strand
r=$(seqkit seq -rp pfizerplasmid.fa|seqkit seq -s);for x in $r ${r:1} ${r:2};do sed 's/.../& /g'<<<$x|grep -Po 'ATG.*?(?=(TAA|TAG|TGA))'|tr -d \ ;done|awk '{print">"NR}1'|seqkit translate|seqkit sort -lr|seqkit head -n1 >reverseorf.fa

# make file where first column shows sequence name and second column shows amino acids
(seqkit seq -s sars2.aa|paste -sd \\0 -|sed 's/^/sars2 /';for x in spidroin reverseorf;do echo "$x `seqkit seq -s $x.fa`";done)>spidsilk

# make table of amino acid percentage in each sequence
awk '{split($2,z,"");for(i in z){a[z[i]][$1]++;sum[$1]++}}END{o="aa";for(j in sum)o=o" "j;print o;for(i in a){o=i;for(j in sum)o=o sprintf(" %.1f",a[i][j]/sum[j]*100);print o}}' spidsilk|sort -nk4|column -t

The output shows the percentage of each amino acid sorted by the column for the reverse ORF:

aa  spidroin  sars2  reverseorf
Y   0.1       4.6    0.1
M   0.3       2.1    0.2
W   0.0       1.1    0.2
N   0.5       5.5    0.9
T   2.5       7.4    1.0
K   0.3       5.8    1.2
F   0.2       5.1    1.8
P   1.3       4.1    3.0
C   0.3       3.0    3.1
I   2.7       5.2    3.2
R   6.4       3.6    3.2
S   0.6       6.8    3.5
E   2.3       4.5    5.2
D   10.2      5.2    5.9
H   5.3       1.9    7.6
Q   10.1      3.8    8.0
L   2.7       9.5    11.7
A   22.4      6.8    12.3
G   18.0      5.9    13.6
V   13.9      8.0    14.2

ChatGPT said:

Spider silk proteins (spidroins) and the reverse open reading frame (ORF) of the Pfizer plasmid exhibit similar amino acid compositions, but for entirely different reasons. In the case of spider silk, the biased amino acid composition is a result of evolutionary selection for mechanical properties such as strength, elasticity, and hydrophobicity. Spidroins are rich in glycine and alanine, which contribute to flexible and crystalline regions of the silk, respectively. Leucine and valine are also prominent, helping to stabilize hydrophobic interactions. Conversely, spidroins contain very low amounts of aromatic residues (tryptophan, tyrosine, phenylalanine) and polar charged residues, as these are not advantageous for the physical properties of silk fibers.

In contrast, the reverse ORF from the Pfizer plasmid is not a biologically meaningful protein. Its amino acid composition is an artifact that arises from codon optimization used to express the vaccine gene efficiently in human cells. Codon optimization increases the frequency of certain nucleotides, particularly guanine and cytosine, to match human codon usage preferences. When this optimized sequence is taken in reverse and read in an alternative frame, it produces a pseudo-protein sequence with an amino acid composition that reflects these underlying nucleotide biases rather than any functional protein-coding information.

As a result, the reverse ORF also shows a high abundance of glycine, alanine, leucine, and valine. This is because codons rich in guanine and cytosine frequently map to these amino acids when read in the reverse complement strand. Other residues like glutamine, aspartic acid, and histidine also appear with elevated frequencies due to similar codon artifacts. The similarity in amino acid composition between the spidroin and the reverse ORF is therefore coincidental, stemming from the statistical properties of the genetic code and the influence of codon optimization, rather than from any evolutionary relationship.

This convergence in amino acid composition leads to misleading BLAST results. BLAST scoring is affected not only by exact sequence identity but also by overall composition similarities. Consequently, even sequences with low identity can produce low E-values if their amino acid distributions are comparable. In this case, the reverse ORF's accidental resemblance to spidroin composition results in false-positive BLAST hits, despite the lack of true homology. This reflects a composition-driven artifact, not an indication of biological relatedness.

The spidroin protein is no longer returned as a match by UniProt. The protein was deleted from UniProt in June 2024 for the reason that that it was an "excluded proteome": [https://www.uniprot.org/uniprotkb/G1Y380/history]

UniProt says that reasons for excluding a proteome include incorrect assembly, contamination, or misidentification of the source organism. [https://www.uniprot.org/help/proteome_exclusion_reasons]

The source organism of the protein at both UniProt and GenBank listed is a bacterium called Nitrospirillum amazonense. But bacteria do not produce spider silk unless they have been modified genetically, and the protein sequence came from a paper which described a natural species of bacteria and not genetically modified bacteria.

The entry for the protein at UniProt was copied from this entry at GenBank: https://www.ncbi.nlm.nih.gov/protein/EGY00023. The entry at GenBank includes some metadata that was missing from UniProt, including a note for the CDS that says "identified by sequence similarity; putative".

ChatGPT said:

The entry shown for Nitrospirillum viridazoti Y2 listing "Major ampullate spidroin 1 MaSp1" is likely a case of misannotation due to automated sequence similarity searches. Here is why this happens:

1. Annotation by Homology: The GenBank entry notes that this sequence was "identified by sequence similarity; putative." This means that during the annotation pipeline, the protein sequence showed local similarity to known spidroin sequences, possibly because of repetitive glycine- and alanine-rich regions or structural motifs that resemble spidroin proteins. Such repetitive domains are common in unrelated proteins across various species.

2. Spurious Similarity to ATPase Domains: The region annotation (COG3903) refers to a predicted ATPase domain, which is a general function category not specific to silk proteins. ATPase domains are found in many proteins across life forms. The resemblance to spidroins might arise from structural repeats or motifs that coincidentally align with spider silk sequences, especially in large, repetitive bacterial proteins.

3. Conceptual Translation Artifact: The comment mentions "Method: conceptual translation," indicating this is a predicted open reading frame (ORF) from genome sequencing data, not experimentally validated. Large bacterial genomes often contain long ORFs with repetitive low-complexity regions that can artifactually match spidroin sequences in databases.

4. Misleading Product Naming: The product is named "Major ampullate spidroin 1 MaSp1," but this is a bioinformatic label assigned due to sequence similarity, not functional evidence. No experimental data supports that Nitrospirillum viridazoti produces spider silk proteins.

5. Source Confusion: Nitrospirillum viridazoti is a nitrogen-fixing bacterium associated with plants, not arachnids. There is no biological reason for it to produce silk proteins. The naming likely results from a bioinformatics pipeline matching a segment of bacterial protein to a spidroin database entry.

This lady on Twitter said that the spidroin clots can be activated remotely (which is similar to the theory by Mike Adams that the calamari clots contain electric circuits that can be triggered by 5G to kill people): [https://x.com/LouiseBrookes8/status/1904546516292821189]

Someone on Twitter said that the reason why the clots are stained by Thioflavin T might be because spidroin has amyloid-like properties: [https://x.com/mvwinds/status/1863467028960706983]

Ulrike Kämmerer said that the reverse ORF actually codes for spider silk, but she didn't mention anything about how the ORF only had an extremely distant match to a spidroin sequence at UniProt, or how the sequence was misannotated. And she said the spidroin is extremely durable, and that once the human body has been instructed to form spidroin, the spidroin can no longer be degraded because it is a foreign protein, which will lead to the buildup of spider silk inside the body. She said it was similar to the accumulation of prions in mad cow disease, and she said the spider silk will destroy cells as it accumulates in human tissue. And she said that Arne Burkhardt had found symptoms of a new type of amyloidosis in people who died from a COVID vaccine, which she speculated might have been due to the spidroin protein. She said this in German: [https://www.aussie17.com/p/biologist-prof-dr-ulrike-kammerer]

And then they looked at the opposite strand and found out that there is a gene inside which ultimately codes for spider silk. There's something in there a spider silk that means spidroin. And that makes even less sense. What does the gene information for a spider silk protein do in a manufacturing vector that is supposed to only produce RNA for the COVID-19 spike protein, SARS-CoV-2 spike protein? [...] Spiders have these extremely durable spider silks, from which the spider webs are built. [...] And this means that this spidroin, this spider silk protein, is produced in human cells. [...] But the problem is, once this protein is formed, it can no longer be broken down by the cells or degraded by the body. We have no mechanisms to break down this protein. [...] It's a foreign protein to which our organism has no response, because it's actually not supposed to be there. [...] So for the body to be able to break down proteins again, which is always a build-up and breakdown process, this only works if they have a certain folding and property. And the mechanisms in evolution are simply intended for human proteins in humans. Spiders are not intended. And these proteins can then no longer be broken down. And that's exactly the problem, they accumulate. You can imagine it like with that mad cow disease, with those prions, which can't also be broken down and accumulate in the brain causing damage. And similarly, you can imagine the function of this spider silk protein in the body. [...] It accumulates, can't be broken down and destroys the cells or the tissue functions. [...] I know from Arne Burkhardt, the sadly deceased pathologist from Reutlingen, who saw strange deposits in slices from deceased due to the RNA injections. that reminded him of a rare disease that does occur in humans called amyloidosis. It looked like amyloidosis to him optically, but he couldn't stain it with the typical methods used for amyloidosis in pathology. This means he has seen a new disease, as he explained to me, where it looks like amyloidosis, but cannot be diagnosed with the conventional methods. That would of course make sense now. Now, one simply has to look in the future, one can also prove these spider silk proteins with targeted antibodies, whether they are actually these spider silk proteins.

Added later: Kevin McKernan told me that a utility called AmyloGram predicted that the reverse ORF was amyloidogenic: [https://x.com/Kevin_McKernan/status/1928488367114580033]

Amylogram predicts that ORF to be amylodogenic.

Who cares what's it's called why are you playing guilt by association games?
Classic chaos agent subterfuge.

People are free to speculate on other peoples data and the person who generated that data isn't responsible for their thoughts.

http://biongram.biotech.uni.wroc.pl/AmyloGram/

Once again.

Lazy Henjin didn't run that novel ORF through any analysis but instead spergs out what its name might be?

Novel ORFs usually mean they don't have good nomenclature you 1W incandescent bulb.

I told him that maybe AmyloGram was designed to be used with sequences shorter than 1252 aa, because the sequences that were included as sample input were between 11 and 23 aa long:

In the paper about AmyloGram, Amylogram was tested on a set of sequences with a length between 6 and 25 aa: "Sequences shorter than six and longer than 25 amino acid residues (8 and 27 sequences, respectively) were removed from the set because the former were too short to be processed in the devised n-gram analysis framework and the latter were too diversified and rare, hampering a proper analysis." [https://www.nature.com/articles/s41598-017-13210-9] The paper also described a benchmark where AmyloGram was compared against other similar utilities, where the length of the input sequences ranged from 6 to 14 amino acids.

I tried generating 10 random 20 aa sequences:

$ for i in {1..10};do printf %s\\n \>$i $(tr -dc ACDEFGHIKLMNPQRSTVWY</dev/random|head -c20);done
>1
MYPYHEMSWGYDCVMVVRFW
>2
WDWWDASEWRHQSHWMIPML
>3
SRGIKGDQSEHANTCLAYSN
>4
CHPPVANPWPIEENSVPRCR
>5
TWTTNGQSIAEGAQRMPDNI
>6
LLLSCPDSLVWMFLPFTMVM
>7
NTAQGWAEPRTIFFKAPFTD
>8
TRADPTGVLEDFNLFSILNY
>9
FYVTIAKQSIAKYLNDIGGK
>10
YDPDTWIQWTCPSMKHPYNE

I also used similar code to generate 10 random 1252 aa sequences. The average amyloid probability was about 0.89 for the 1252 aa sequences but only about 0.52 for the 20 aa sequences:

McKernan got an amyloid probability of about 0.85 for the reverse ORF, so it was actually below the average amyloid probability of my 10 random 1252 aa sequences.

Ana Maria Mihalcea

Ana Maria Mihalcea has a unique theory on how the calamari clots are formed, because she told Mary Holland from CHD that the clots are formed when nanobots eat red blood cells: "I analyzed these clots microscopically and found these nanotechnological filaments in there. And Clifford Carnicom and I - we also did chemical analysis on them. I also filmed how the clots actually assemble. What you see is unvaccinated blood, the nano robotic swarm. You see all these green and orange and yellow lights. And they are hijacking the electricity from the red blood cells, and they're killing them basically to feed themselves. It's called energy harvesting, it's well described in the nanotechnological literature. And so these robots then, what they leave in their wake is this. This is the same blood 30 minutes later. The blood is completely destroyed. The robots have moved on. And this is the rubbery clot that we've been seeing. And that you can see how it self-assembles, and literally builds when you are leaving the - when you're drawing the blood, and you are leaving it out for at least four hours." [https://rumble.com/v5gadat-what-is-in-our-blood.html?start=2510] The image below shows her "nanorobotic swarm" of green and orange and yellow lights (and it's also depressing to note that her interview with CHD has 101 upvotes and 1 downvote on Rumble):

During the interview with Mary Holland from CHD, Mihalcea also said:

But somehow Mary Holland didn't have anything critical to say to Mihalcea, and she never asked Mihalcea questions like "How do you know that?" or "What's your source?" or "How can you see nanotechnology with a light microscope?" or "Isn't that just Brownian motion and not quantum dots?"

Ana Maria Mihalcea wrote that Hirschman's clots contained Morgellons bacteria and Morgellons filaments: [http://web.archive.org/web/20230711070359/https://anamihalceamdphd.substack.com/p/blood-clot-analysis-from-living-and]

Our findings:

  1. The filament structure is a 1:1 match to our previous findings as well as consistent with 30 years of research done by Clifford Carnicom.
  2. Cross Domain Bacteria, the origin of filament genesis are visible within the clots
  3. This appears to produce an amorphous protein structure
  4. Stray blood cells are present

It appears that the rubbery clots are a more advanced and extreme evolution of the CDB/ Morgellons filaments.

CDB or cross-domain bacteria is Clifford Carnicom's name for the supposed causative agent of Morgellons disease. Ana Maria Mihalcea also claims that chemtrails contain both Morgellons filaments and spider silk: [https://www.google.com/search?q=site:anamihalceamdphd.substack.com+chemtrail+spider+silk]

In September 2023 Richard Hirschman wrote this about his clots: "I know that there have been some people looking into them. publicly the only people who have spoken about what they have found or seen are, Dr. Ryan Cole, Dr. Ana Mihalcea and Mike Adams. There have been others but I am not aware of any of their findings." [https://x.com/r_hirschman/status/1700596168256880863] But if Hirschman was for real, would he have wanted Ana Maria Mihalcea to say that his clots contained Morgellons filaments, Morgellons bacteria, and spider silk? Or would he have wanted Mike Adams to say that his clots contain electric circuits and nanowire interface structures? I haven't found him denouncing the claims by Mike Adams or Ana Maria Mihalcea anywhere. [https://x.com/search?q=from%3Ar_hirschman+%28mike+adams+OR+mihalcea%29&f=live]

Ana Maria Mihalcea is a member of a neo-Theosophical cult called Ramtha's School of Enlightenment. Their leader JZ Knight claims to be channeling a 35,000-year-old Lemurian ascended master called Ramtha. Mihalcea wrote a document about the medical miracles that were manifested in the body of JZ Knight, which included that JZ Knight's DNA changed to male DNA while she channeled the ascended master: [https://docs.wixstatic.com/ugd/72ba1c_2971020dc9154de89ba121994d187882.pdf]

The description of a book Mihalcea wrote about light medicine says: "Based upon teachings by Ramtha the Enlightened One, Dr. Mihalcea presents a new way of assessing molecules of healing according to their light value. She explains the remarkable, scientific documentation of the great American Channel, JZ Knight, as an extraordinary example of how one's divine spirit can manipulate the matter of the physical body." [https://www.quantum-cafe.com/list/style.ashx?style=9780578850283]

When Carnicom and Mihalcea looked at dental anesthetic under a microscope, they found Morgellons bacteria and self-assembling microchips: [https://anamihalceamdphd.substack.com/p/discussion-of-microscopy-of-dental]

Clifford Carnicom supposedly isolated Morgellons bacteria, which enabled him to grow a polymer goo in a lab that he said "appears to be visually and chemically identical to" calamari clots: [https://anamihalceamdphd.substack.com/p/rubbery-clot-grown-in-a-petri-dish, https://carnicominstitute.org/maturation-of-a-biopolymer/]

In 2024 Jeff Berwick from The Dollar Vigilante started selling a Tesla healing machine for 11,111 USD. He claims the machine is based on "plasma healing technology that has been hidden by time (and Donald Trump's uncle)". The website for his Tesla healing machine includes an endorsement from Ana Maria Mihalcea, who said "Total miracle... Tumor just fell off": [https://tzla.club/]

Ana Maria Mihalcea said that she embarked on her nanobot quest because of David Nixon: "So my life changed when I'm at at a meeting - Medical Doctors for COVID Ethics International met Dr. David Nixon, and one day he asked me if I wanted to take a look. He's an Australia and he was looking under the microscope at a Pfizer - at the Pfizer vowel contents - and I saw up in front of my eye self-assembling nanotechnology, and that changed absolutely everything for me, because I knew that that was the truth, and that what the implications of what that would mean. I already knew about the transhumanist agenda - that they wanted to wage war against the soul and the spirit of humanity. And so I started studying nanotechnology and everything that I was seeing, and got involved in groups and then finally did my own live blood analysis." [https://rumble.com/v3czz6o-national-arms-ban-the-jab-forum.html?start=592]

Medical Doctor for COVID Ethics is a splinter group of Doctors for COVID Ethics. M4DCE hosts Zoom meetings hosted by Charles Kovess that often feature a large number of participants. [https://charleskovess.com/frostmeeting1/, https://rumble.com/user/cbkovess] I didn't find any presentation David Nixon did for M4DCE, even though both Nixon and Mihalcea might have attended a Zoom meeting for a presentation by some other person.

The earliest public interview of David Nixon I have found was published by Ana Mihalcea in October 2022. [https://anamihalceamdphd.substack.com/p/new-images-of-self-assembly-structures]

David Speicher speculated that the calamari clots are made of protein coded by the reverse ORF

An account that promotes Miles Guo posted this video where Ana Maria Mihalcea said that she had found spider silk in calamari clots, and she included a slide about the reverse ORF from a presentation by David Speicher, which featured a photo of calamari clots as if the clots were somehow related to the reverse ORF: [https://x.com/aus_mini/status/1813411573085692059]

In an interview David Speicher did in September 2024, he said: "If you encode going reverse, you get another intact open reading frame that's perfectly intact. You get this whole fibroin heavy chain, which is major ampullate spidroin 1, MaSp1. And that is the same fibroin that's found in silkworm silk. And what are we pulling out of the dead vaxxed people? All of these white fibrinous clots. And these silk proteins are used in spider silk. The thing about spider silk is that if it's in the spider at the right pH and the temperature, it's a liquid form. If it's outside and it cools and the pH changes is when things start to solidify and make silk. So I think - and a lot of groups worldwide are looking at this - but there could be a major link between these clots and what's actually in the intact plasmid DNA." [https://www.drtrozzi.news/p/genetic-invasion-an-update-with-dr, time 27:28]

Speicher showed the slide below where the percentage identities of the matches were covered up, so people couldn't see that the proteins that matched the reverse ORF had only about 25% identity. His image showed that most positions of the amino alignment did not match, but many of his followers probably failed to understand what the alignment meant. And Speicher didn't say anything about how the match to the spidroin protein had an extremely low identity and how it was likely due to chance:

When Speicher said that "you get this whole fibroin heavy chain, which is major ampullate spidroin 1, MaSp1", he mixed up the spider silk protein that was the first match with the silkworm silk protein that was the third match. But they were two different proteins, and the fibroin is not a spidroin and the spidroin is not a fibroin. And both proteins had the host species listed as a species of bacteria which doesn't produce either spider silk or silkworm silk, so both sequences were likely mislabeled, and they have both now been deleted from UniProt.

Speicher also showed this slide which suggested that the calamari clots might be connected to the reverse ORF:

Speicher has a PhD degree in virology, and he has done a postdoctoral fellowship in bioinformatics, so I have a hard time believing he would be stupid enough to think that the reverse ORF would actually code for spider silk. It seems more likely that he is deliberately promoting disinformation. But he is also one of the main people who have pushed Kevin McKernan's narrative about DNA contamination, which I think increases the likelihood that it's a disinformation narrative (even though the DNA contamination itself seems to be real, but its implications seem to be vastly exaggerated by McKernan and Speicher). But it's interesting that McKernan is now also one of the people who is supposed to have analyzed the calamari clots in a lab.

In October 2023 a preprint about DNA contamination was published by David Speicher, Jessica Rose, Maria Gutschi, David Wiseman, and Kevin McKernan. [https://osf.io/mjc97_v1/] In 2023 Maria Gutschi did a presentation where she said: "So Kevin and group tried to determine what does this protein make - what does mRNA make. The closet thing they found was silk protein, spider protein. Spider silk. Wow. And so, we don't know if that's happening or not - there's a lot that needs to be done - and whether that is the case. But it is a large concern on my side. Because it is not an accident that this mRNA is there on the opposite side. In my opinion it's not." [https://crowdbunker.com/v/23fVajqu, time 26:25]

Jessica Rose has written many Substack posts where she has presented Kevin McKernan's findings in a popularized format. She also wrote a Substack post about the reverse ORF, where she spent most of the post writing about spider silk as if it would somehow be relevant to the reverse ORF, or as if people needed to learn about spider silk to understand the reverse ORF. [https://jessicar.substack.com/p/what-a-tangled-web-we-may-have-weaved] She also wrote about a paper titled "Spidroin N-terminal domain forms amyloid-like fibril based hydrogels and provides a protein immobilization platform", and she concluded the post by writing: "Could it be that amyloidogenic peptides akin to spidroin are being translated in people and subsequently creating immobilizing hydrogel scaffolds for other proteins?" (But Bryan Ardis also said that the calamari clots are made up of two snake venom peptides in hydrogel, and Ana Maria Mihalcea has said that the clots are made of both hydrogel and spider silk. This McKernan-Rose-Speicher-Kämmerer network is starting to look like a backup net that catches people who are too refined to be captured by the Peters-Ruby-Ardis-Mihalcea net.)

In her Substack post, Jessica Rose briefly mentioned that the reverse ORF had a weak homology of only about 25% to the spidroin protein, but she didn't write about how the match was likely due to chance, and how the spidroin had nothing to do with the reverse ORF, and there were many other random proteins that had a similarly close match. And she didn't even post instructions on how people can repeat the BLAST search themselves. I called her out for how misleading the post was, because she must have known it would be misinterpreted by her readers. [https://x.com/henjin256/status/1848961827415249112] Jessica Rose has a PhD degree in the computational biology of viruses, so she should've known the reverse ORF had nothing to do with spider silk, so her post seemed like she was deliberately trying to mislead people.

In March 2025 Richard Fleming published a PDF by the Czech biologist Soňa Peková, who is supposed to have verified McKernan's finding of DNA contamination, and who is basically the Jessica Rose type figure of the Czech Republic. It might be a coincidence, but Soňa Peková is a member of a neo-Theosophical cult called ALLATRA that has many similarities to Ana Maria Mihalcea's cult: https://jessicar.substack.com/p/the-new-slovakian-report-showing/comment/100916301. ALLATRA teaches that reality is oppressed by Draco Reptilians, that Slavs are the oldest ethnic group after the fall of Atlantis, and that there is a 12,000-year pole shift cycle. In one of her interviews Soňa Peková talked about Pleiadians and 5D ascension, and she said that Gaia has the capability to reach not only 5D but 9D reality, even though vaccinated people may not be able to reach a higher dimension. Even though the cult is overtly based in Ukraine, they run a multilingual media operation that produces content in various languages, and their most popular content are English-language deep fake videos that employ the avatar of an American veteran spook called Egon Cholatkian. And in the same way that Scientology is partnered with the Nation of Islam, ALLATRA is also partnered with an African American freemasonic lodge called the World's Masonic United Nations.

In August 2025 Kevin McKernan came up with a new theory that the clots might be caused by a cryptic ORF in the SV40 promoter, and Speicher promoted McKernan's new theory: [https://x.com/DJSpeicher/status/1958400150155530596]

White fibrin clots in surgical drain tubes

A user on Twitter said that the clots in the thumbnail of this video were "calamari-like clotting", even though the clots had formed inside a surgery drain tube: [https://x.com/CheweyLife/status/1914528829890068632]

But an MD user replied: "Uhm, yeah. After week of surgery drainage, white clotting in them is not unusual at all. After all its the fibrin rich wound secretions drained through plastic tubes. Usually you pull them, before they clot. Its totally different to havin white clots build-up inside blood vessels". [https://x.com/53v3n0fn1n3/status/1914690994529849616] The user also wrote: "Clotting cascades are triggered on the wounds surface. Clotting in these tubes starts when the suction doesn't work properly. Some get them, some don't. Lymphadenectomy can leave a huge wound inside, so drain is left as long as secretion keeps going, weighed with inf. risk."

Later when another user posted a video of the clots in a surgery drain tube, the MD user pointed out that it was a surgery drain tube, and that wound secretions that are drained by the tube have a high fibrin content: [https://x.com/53v3n0fn1n3/status/1915703836171215355]

Richard Hirschman also shared the same video by the lady who showed the clots in a surgery drain tube, and he wrote: "The clots she shows look very similar to the ones that I have been seeing during the embalming process, the difference is she's alive and those who I embalm are not. If the clots are the same, they can't just be postmortem. There was a vascular surgeon whistleblower who spoke with Dr Philip McMillan about the same type of clots that he has been seeing. How does a vascular surgeon remove postmortem clots during the surgery on a living person?" [https://x.com/r_hirschman/status/1914458661021475307]

In March 2024 NZDSOS tweeted this photo of "rubbery white structures being discharged through a surgical wound drain site" (but it may have just shown regular clots in a surgical drain tube): [https://x.com/nzdsos/status/1767386236925387026]

The earliest place where I found the same photo posted was in the blog of NZDSOS, where the photo was not given any source but its caption said "Photo Provided for Use - Copyright Free". [https://nzdsos.com/2024/02/20/rubbery-clots-campbell/] So I guess it's an original photo published by NZDSOS.

Greg Harrison also posted the photo and two other photos which he said were clots that came from living subjects: [https://x.com/Greg21143362/status/1776172411819594066]

Artificial clots can be created with a Chandler loop device

Some of the clots that are presented as calamari clots may have been created by a device like a Chandler loop device, where blood is repeatedly passed through a tube until clots form in the tube. Here's images of blood clots created with a Chandler loop device (where the scale bar is 2 cm, so the longest clot in image L20 is about 30 cm): [https://link.springer.com/article/10.1007/s10856-023-06721-7]

The image below demonstrates how the device works: "A photo of the assembled Chandler loop apparatus with blood running in the device. C Illustration depicting clot formation within the Chandler loop at the forward meniscus".

In another study a Chandler loop device was used to produce clots that had close to a pure white color, as can be seen from images A and B below: [https://link.springer.com/article/10.1007/s10856-024-06775-1]

In order to manufacture clots with the amyloid properties observed by Kevin McCairn, perhaps bacterial LPS could be added to the blood to induce misfolding of fibrin, like what was done by Pretorius and Kell who wrote: "Here, we show that the addition of tiny concentrations (0.2 ng l(-1)) of bacterial LPS to both whole blood and platelet-poor plasma of normal, healthy donors leads to marked changes in the nature of the fibrin fibres so formed, as observed by ultrastructural and fluorescence microscopy (the latter implying that the fibrin is actually in an amyloid β-sheet-rich form that on stoichiometric grounds must occur autocatalytically)." [https://pmc.ncbi.nlm.nih.gov/articles/PMC5046953/]

Mike Adams is supposed to have found tin in the clots with ICP-MS. I thought it might have been if the clots were made with a Chandler loop device, and the tubes of the device were made of a material like PVC that contained tin. But ChatGPT said:

In most published studies, the tubing in Chandler loops is not PVC (polyvinyl chloride), but rather silicone tubing. Silicone is chosen because it is flexible, biocompatible, transparent, and relatively inert with respect to protein adsorption and platelet activation.

PVC tubing is generally avoided in hemocompatibility studies because:

That said, some modified Chandler-type systems or other blood loop devices may use fluorinated ethylene propylene (FEP), Tygon®, or other specialty tubing, depending on the study.

I have also thought that the objects that are presented as calamari clots might be clots from surgical drain tubes. But when I asked ChatGPT if surgical drain tubes are made made of PVC or a material that contains tin, it said:

Surgical drains and pleural catheters are not usually made from PVC, and typically do not contain organotin stabilizers (which are sometimes used in PVC formulations). The materials are selected for flexibility, biocompatibility, and minimal tissue reaction.

Here is a breakdown by device type:

Regarding tin compounds:

Letter from an endovascular surgeon to Philip McMillan

Philip McMillan offers a free online course about the calamari clots, which is basically just a website where you have to enter an email address in order to see the content. The course features a section titled "Observations from Endovascular Surgeon", which consists of a 5-page document that looks like a letter from a surgeon to McMillan: [https://vejonhealth.learnworlds.com/course/embalmers-clots-composition-and-cause, f/mcmillan_letter_from_endovascular_surgeon.txt]

The surgeon wrote that they had not seen calamari clots in their lab: "Anyway, I was looking for examples of what I heard your guy talking about. We also did a lot of vein patients but, once again, though I was watching out for these cases, I never saw/heard about any of our patients (and we had a very active Vein Practice, at least prior to Covid) having extensive venous blockages like your witness produced. DVT's are not that uncommon in a very busy vein ablation practice. We were doing upwards of 30-45 venous ablations a week, on average, prior to Covid. Covid really did a number on us, like other clinics, especially when people started locking down. But the DVT's that we experienced post mRNA Vaccine deployment, and once again, the vast majority of our patients were mRNA vaccinated, their clots were easily managed and fully resolved with a course of anticoagulative treatment, usually within 2-3 weeks. There had to be one in there, but maybe we just didn't identify it."

The surgeon also wrote: "Without understanding the timing of onset of theses white, fibrous clots, when they began forming, either weeks/months prior to their event or just days before their event, I don't know how we could have missed these blockages during the procedures. Moreover, all of our patients, within a week or two prior to a venous ablation or arterial intervention, had a full vascular ultrasound study that would certainly have demonstrated these obvious tissue amalgamations, even the smaller ones. Most certainly the larger ones I've witnessed on your podcasts with your whistleblowers and your embalmers. No way, with our technologist talents, could these growths have been missed."

The surgeon speculated that the reason they weren't seeing the clots may have been if the clots formed soon before death: "The only real conclusions I can come to, during the entire time of witnessing our practice's patient demographics and the procedures we performed on them, and many of them were repeat customers, sometimes requiring multiple repeat annual interventions, is that these blood clots, fibrous or jelly, must happen rather abruptly, because our patients typically receive follow up vascular Ultrasonography 2-3 times per year, and we never noticed these large blockages that would certainly, without a doubt be able to visualized. Our equipment was the best. Our very best techs would have found them too. My surgeon partner looked at every single study personally. Nothing out of the ordinary, anyway. So this makes me hypothesize that these structures must form very quickly in an acute way, resulting in the patient needing an emergency trip to the hospital, or dying and going to the embalmers." However for example Tom Haviland has said that the reason why morticians say they only started seeing the clots in mid-2021 might be if the clots take about half a year to form. And Nicky Rupright King said she didn't start seeing the clots until 2022, and she suggested the clots might take more than a year to reach their full size. And anyway if the clots only take days to form, then why weren't embalmers already seeing the clots in January 2021?

The surgeon who sent the letter to McMillan wrote: "Unlike the clinic of the Whistleblower in your podcast, that was a hospital that did every body part, from the brain to the heart to the lower extremities, we were limited to doing pelvic and lower extremity endovascular atherectomies and angioplasties. Of course we did some stenting, when necessary." But I don't think that would explain why people in his lab were not seeing any calamari clots. A more likely explanation is that the clots are a hoax, and McMillan's cath lab whistleblower was lying.

I didn't find the surgeon's letter published anywhere else. I also haven't heard McMillan mention the letter anywhere, and I didn't find it published on his blog, which might be because the letter conflicts with the narrative about the clots he is trying to present to his audience.

There's a user on Kevin McCairn's Discord server who works as an ER doctor, but she said she hadn't seen the clots even though she had done many CT and MRI scans:

McMillan's high school friend Azzard Comrie who saw clots during autopsies

In February 2025 Philip McMillan published an interview with Dr. Azzard Comrie from Jamaica, who claimed he saw the novel type of clots during autopsies. [https://philipmcmillan.substack.com/p/doctor-speaks-out-about-shocking]

At the start of the video McMillan said: "So over the period of time we have been asking questions about has anyone else seen these clots, has anyone else stepped forward? And the fact that nobody has come forward seems to give the impression that this is not occurring, or if it is it's only random and not too significant." And that's in fact the impression you get, because there's only a handful of people I can think of who are not morticians but who claim to have seen the clots in human bodies, but several of them have been interviewed by McMillan.

After that McMillan said that Azzard Comrie was his friend from high school: "This is someone that I know - and therefore he has independently however reached out to me - so I have known him for many many years from my high school days, because we were at a similar school. And he's also a practicing doctor. But I haven't been in contact with him for a long time. And so him reaching out to me at this point is representative of the fact that he wants to raise awareness of this, not necessarily because of our direct connection."

But what are the odds that one of the few non-morticians who claims to have seen the clots happened to be a childhood friend of the same guy who was contacted by the anonymous cath lab whistleblower?

Comrie didn't have his own photos of clots. McMillan showed the photo below from his cath lab whistleblower, and he asked Comrie if it was similar to the new types of clots he was seeing, but Comrie said: "Very similar. You just take that top half, and that's exactly what it would have looked like." [19:24] However the photo looks like a regular red clot and not a novel type of clot:

At time 21:45 McMillan asked: "So when you started to see this? This should have been in about 2021 then?" But Comrie answered "Yes." And Comrie said he didn't remember seeing the clots in people who died from COVID 2020.

McMillan also wrote that Comrie observed unusual effects of vaccination, including a drastic drop in the level of vitamin D, an entire group of workers developing hypertension, and the heart increasing to nearly six times the previous size:

B12 and Vitamin D Deficiency:

Rise in Thyroid Disorders and Hypertension:

Drastic Cardiac Changes:

ChatGPT said that in severe cases of cardiomegaly, the heart can enlarge up to 2 to 2.5 times its normal size, but that a sixfold increase would be incompatible with life.

During the interview Comrie didn't say the heart was exactly six times the normal size, but he said "If I had to tell you based on what I heard, it was probably about six times the size." [45:08] He also said that the man with the huge heart had his vitamin B12 level drop from almost 400 to 66 pg/ml.

Added in June 2025: Philip McMillan now said this about his interview with Azzard Comrie: "A lot of people keep thinking that if this was happening, everybody would know. And I'm saying you are underestimating how significant and how powerful the censorship was. Tom, you had been talking to medics as well. Now just to put it into context, only in the past maybe 6 to 8 months, I have spoken to the first medical doctor in the world who was actually doing autopsies and saw these clots."

By the first medical doctor in the world, I think McMillan meant the first doctor who was speaking out about seeing the clot when they did autopsies. However Ryan Cole already claimed in March 2022 that he had pulled out a long calamari clot from a vein, even though he didn't make it clear if the clot came from a body he did an autopsy on. [clot2.html#Ryan_Cole_interviewed_by_Steve_Kirsch_in_March_2022]

Watch the Water 2 and Shankara Chetty on snake venom

In May 2023 Stew Peters released a sequel to the Watch the Water film, where Bryan Ardis said that COVID was caused by snake venom in tap water. [https://rumble.com/v2nh8xc-premiere-watch-the-water-2-closing-chapter.html]

At time 14:48 Ardis said: "The actual textilinin protein from the eastern brown snake prevents your body's plasmin from breaking down the blood clots. And it's published by them. We have created a self-assembling nanoparticle hydrogel that causes rapid blood clotting, rapid blood clotting. And it is resistant to plasmin being able to break it down, warfarin from being able to break it down - which is cuminin, a blood thinner - and it's also heparin resistant. And what did you find in every ICU with COVID-19 patients? They were heparin resistant. Why? They had ecarin in their body and textilinin." Then Stew Peters asked: "Is that what's causing these white fibrous things that embalmers are finding?" And Ardis replied: "1000% that's what's causing them." So Ardis said he was 1000% sure that the calamari clots were caused by two snake venom proteins.

At time 37:46 Stew Peters pointed out how Ardis was holding a vial with calamari clots when he spoke on the ReAwaken America Tour. And Ardis said they were clots he got from Richard Hirschman, and he again said that the clots are produced by a hydrogel that contains snake venom proteins. And he also talked about an Italian paper by Carlo Brogna et al. where the authors found snake venom peptides in the blood and urine of COVID patients.

At time 40:41, Ardis said: "Just January 28th of 2023, just a few weeks ago, Dr. Chetty MD out of South Africa - is working this entire time - I have been on Zoom calls with this guy for three years now, as we're learning about COVID, how to treat COVID, the success they're seeing in South Africa. Dr. Chetty is a great, honest, ethical human being. He has done phenomenal work. He stated in an interview on January 28th, 2023 - that in long-hauler COVID patients who are coming to his clinic from around the world - they couldn't get them better with traditional therapies they found worked with other COVID patients. So they ran fecal tests on them to find out is there anything in their body we're unaware of that would keep these people sick with long-hauler COVID symptoms?" Then the video cut to a clip where Shankara Chetty said: "At that point that we realized we need to look at stool samples. We need to - if it was found in sewage, and I couldn't understand why a virus found in sewage was not tracked backwards to the gastrointestinal tract where it arose, and to figure out what it was doing there. And so we managed to contact Carlo Brogna, who's done some very interesting work on coronavirus. Uh, what he very basically discovered with looking at stool samples was that the virus was replicating, somehow, in these stool samples, and the stools had toxins - protein-based toxins in them. He found with the incubation of the supernatant of this sample on fresh uninfected stool that the viral title rose exponentially and so the toxins as well. And so he proved bacterial phage activity, that this virus has the ability to infect the bacteria of your gut. And he found toxicities there, toxin-like peptides, which were akin to many different kinds of snake venoms, sea-snail poisons, shellfish poisons. And it's a wonder how those got there." Then Ardis said that one way venoms are manufactured synthetically is using bacteria like E. coli, and another way is using mammalian cells, so the mRNA vaccines also contain instructions that cause both bacteria and human cells to produce snake venom.

Shankara Chetty also wrote on Twitter that SARS-CoV-2 not only acts as a bacteriophage, but that it also modifies the DNA of bacteria through insertional mutagenesis to make bacteria produce snake venom. He also said that Tau Braun told him to keep an eye on snake venom in 2021: [https://x.com/ShankaraChetty/status/1900893736399217058]

Tau first mentioned snake venom to me in 2021 to keep my eye on. He understood that it was being experimented on to be weaponised and could be aerosolized etc. and spread, but I couldn't figure the transmission to other individuals by those affected. He planted the seed and asked that I don't disregard an envenomation as my treatment would address both Envenomation and Hypersensitivity. With the chronic gut issues we were seeing and a positive rectal PCR swab reported early on from China, we contacted Carlo Brogna, who was examining stool. What he found was that the virus had bacteriophage activity and infected the bacteria in your gut, replicating in them and getting them, through insertional mutagenesis, to produce toxins. These toxin like peptides resemble many different kinds of snake venom, conotoxins (sea snail venom), and starfish toxin.

That was the revelation that solved all my questions. Transmission of the toxin occurred through transmission of its code by the virus to the gut bacteria that then made the toxin. This allowed the toxic proteins to evade the hosts' digestive enzymes in the stomach and small intestine by being made directly in the colon where it can be absorbed unaltered.

UNNATURAL, INTENTIONAL, WELL PLANNED, TRANSMISSIBLE ENVENOMATION.

In order to insert DNA into a bacterial genome through insertional mutagenesis, I think SARS-CoV-2 would need to have reverse transcriptase. ChatGPT said:

SARS-CoV-2 is a positive-sense single-stranded RNA virus.

To cause insertional mutagenesis (i.e., inserting sequences into host DNA genomes), its RNA would need to:

  1. Be reverse-transcribed into DNA.
  2. Be integrated into the DNA genome of the host (e.g., a bacterium or a human cell).

This process requires:

Since SARS-CoV-2 lacks both enzymes, it cannot perform insertional mutagenesis on its own.

Chetty also wrote that Tau Braun was one of his guardian angels, and Chetty said that he and Tau Braun were snake oil salesmen (presumably since they are both trying to sell the story about snake venom):

Tau Braun's bio says that he is a "U.S. National Counterterrorism & EMS Advisor and Trainer", and he has been a speaker at a bunch of emergency management conferences. [https://www.drtaubraun.com/about] In 2022 he told Jane Ruby that calamari clots are made of tissue that was programmed to grow snake venom glands by nanobots that used graphene oxide as a delivery mechanism. [http://web.archive.org/web/20221115233622/https://stewpeters.com/video/2022/11/the-jabbed-are-growing-animal-venom-glands-and-ducts/]

In Watch the Water 2 Bryan Ardis said that he had been on Zoom calls with Chetty for three years now. But there's not too many people in the COVID conspiracy movement who are as ridiculous as Tau Braun and Bryan Ardis.

Shankara Chetty is Philip McMillan's sidekick who is frequently featured in videos on the Vejon Health channel. I started to think that McMillan was likely controlled opposition after he published several videos and posts where he promoted Greg Harrison's ORF hoax, but now that I know how his sidekick also promoted the story about snake venom, I have even more reason to suspect that McMillan is not sincere.

Shankara Chetty reposted this video which said that COVID vaccines completely destroy the pineal glands of vaccinated people: [https://x.com/ShankaraChetty/status/1929607618743427098]

Ana Maria Mihalcea's microscope images of embalmed blood from Hirschman

In 2023 Ana Maria Mihalcea said that Hirschman had sent her a sample of blood mixed with embalming fluid from a body he had embalmed, and she went on Maria Zeee's show to show microscope images of the sample. [https://web.archive.org/web/20230614195806/https://anamihalceamdphd.substack.com/p/my-interview-with-maria-zeee-bidens, https://rumble.com/v2u31yo-dr.-ana-mihalcea-bidens-universal-nanotechnology-vaccine-and-zombie-blood.html]

She didn't say if Hirschman received consent from the family members of the dead person for their blood to be paraded around by scammers (even though it's fairly likely that Hirschman didn't even send her a real sample of blood from an embalmed person).

She said that the calamari clots were made of hydrogel, but she also said that fiber-like structures she saw in the blood under a microscope were made of hydrogel. It reminded me of how Kevin McCairn says that the calamari clots are made of amyloidogenic peptides, but he also says that mystery fibers in his microscope images of blood samples are made of amyloidogenic peptides.

At time 31:07 Mihalcea showed the image below and said: "Just showing you these hydrogel classic ribbons that we've seen in the meat and the rainwater - we've seen them vaccinated and unvaccinated blood - and it's the same stuff that Clifford Carnicom and I looked at that also has functional groups that are consistent with hydrogel. And this is a close up. This is very similar to what Mike Adams saw in the microscopic analysis of the large clots, with this central, you know, hollow lining."

At time 40:56 Mihalcea said: "Look at this. All of a sudden, how is it possible that that the control of these blinking lights is creating the fluid to come out? This is exactly the process that David Nixon filmed to create a microchip, okay." And then Maria Zeee said: "Yes. And I mean, I watched that. People that have watched that have seen it. There's like that - there is a clear interaction between all of the materials forming, even to the point of what appears to be little robotic arms setting parameters, so that this part of the what appears to be a chip doesn't form. And it pulls, it looks like it's pulling out the rest to make the perfect shape." A year earlier Maria Zee had broken the news about how David Nixon found self-assembling robot arms in COVID vaccines. [https://zeeemedia.com/interview/world-first-robotic-arms-assembling-via-nanotech-inside-covid-19-vaccines-filmed-in-real-time-dr-nixon/]

At time 41:46 Mihalcea showed the image below, and she said it showed a hydrogel ribbon that was assembled out of blinking lights: "Are you able to see this filament here? Yes. Okay. So this 20 minutes later, that drop looked like this. It had built this hydrogel ribbon. And you can see that all of the surrounding blinking lights were actually used to create this thing. That wasn't there before. And this is the kind of hydrogel ribbons that we see in the blood 20 minutes to assemble this ginormous ribbon."

At time 50:59 Mihalcea said her sample also contained self-creating spheres: "So the entire blood area was filled with these kinds of spheres that were self-creating, and that had these small light particles in there that looked like they were emitting photonic light."

At time 1:07:45 Mihalcea said that calamari clots grow in the presence of a pulsed electromagnetic field, so an MRI scan might make the hydrogel clots grow bigger: "Well, uh, how about this? Um, so we've shown the pulsed electromagnetic fields, and just exposing the live blood of a vaccinated person - shows that the clot of this, the - the rubbery part of the clot, the hydrogel clot makes it grow. So how many people are getting an MRI scan, even the freedom doctors who are recommending an MRI for the heart to look for myocarditis? Is that making the hydrogel inside of them grow? So if you don't know that certain fields are affecting this technology and could have an adverse effect, and you don't even know it's in people, then you don't know how to take precautions. And so, uh, clinicians need to start learning about this. Because, again, you know, what if you make somebody's clot grow?" And next she said she had found microchips growing in dental anesthetics.

Chad Whisnant's wife said that the clots shown in Died Suddenly were not out of the ordinary

A FactCheck.org article about the Died Suddenly movie said the following: [https://www.factcheck.org/2022/12/scicheck-died-suddenly-pushes-bogus-depopulation-theory/]

Over the last year or so, Hirschman brought in people he worked with as a contract embalmer in Alabama. He knew three of the morticians who appeared in the video, he said.

One of them is Chad Whisnant, whose name is spelled incorrectly in the video.

Whisnant runs a funeral home in Alabama with his wife, Brooke.

He didn't return our call for comment, but Brooke Whisnant told us in a phone interview that the clots shown in the video aren't out of the ordinary and that she doesn't share her husband's view of vaccination, which has changed over the last several years.

"I'm now an antivaxxer," Chad Whisnant said in the video. "I wasn't before."

"It's been a slow, slow process ever since Trump took office," Brooke Whisnant said of her husband's shifting beliefs after former President Donald Trump took office in 2017. "It's been a very weird abyss of misinformation on the internet," she said.

The comments by Chad Whisnant's wife seem to indicate that Whisnant is himself a sincere conspiratard, which makes it seem less likely that he was some kind of a plant in the conspiracy movement who had been tasked with producing disinformation. But nevertheless it's interesting that even though his wife ran the funeral home with him, she said that the clots that were shown in the Died Suddenly movie were not out of the ordinary.

Chad Whisnant was featured prominently in the Died Suddenly movie, but I haven't found any other place where he has appeared in alternative media. Whisnant's name was misspelled in the Died Suddenly movie, but when I searched Twitter for the properly spelled form of his name in double quotes, I found only two tweets which referred to him. [https://x.com/search?q=%22Chad+Whisnant%22&f=live]

Hirschman's debut interview with Jane Ruby in January 2022

During Hirschman's debut interview he did with Jane Ruby, he said: "It all started - I can't put my finger on it - but probably around the mid, middle of last year." [https://rumble.com/vtcsgw-worldwide-exclusive-embalmers-find-veins-and-arteries-filled-with-never-bef.html?start=128] In other early interviews Hirschman similarly said he started seeing the clots around mid-2021, but later he changed his story to say he might have already seen the clots earlier.

Jane Ruby asked: "Mostly you're seeing them and pulling them from veins, not arteries. Is that correct?" [8:44] Then Hirschman answered: "Yes. But on this one here I also got one out of the artery as well. Which is unusual. I have here lately been pulling some out of arteries. I pulled one out of an artery last night." So he made it seem like the clots were more common in veins than arteries. However later on Hirschman started to say that the calamari clots were appoximately equally common in veins and arteries. For example in January 2023 when Chris Martenson asked Hirschman if the clots were coming out of veins and arteries "even-steven" (which means evenly matched), Hirschman answered "Yes, exactly." [https://rumble.com/v25vb6u-embalmers.html?start=1500] During an Hirschman did with Daniel Horowitz in February 2021, which I believe was Hirschman's third interview, he gave the impression that he saw the clots in veins at first and arteries later: "These clots are unusually firm. They're unusually long. Sometimes they're short. Sometimes they're long. They're just - sometimes it looks like they - that you can literally see how they're branching into different areas of the vein. But then I also started noticing them starting to appear in arteries, which is very unusual." [https://podcasts.apple.com/us/podcast/are-the-vaccines-causing-solid-frankenstein-blood/id1065050908?i=1000551322493, time 29:19]

But anyway, next Jane Ruby asked: "Was there any difference in what you observe from the one you pull from arteries compared to the ones you pull from veins?" [9:39] But Hirschman said: "The ones I pull from veins are much larger usually." That's another detail he may have omitted in his later interviews, even though I'm not sure.

Then Hirschman said: "They usually have that long strange whitish substance to it, usually a little bit of blood that's attached to it. Sometimes it seems like they're intermingled. It almost seems like the white grows almost out of the blood, as weird as that sounds. Some people are calling me - I call them worms, because to me they represent - they look very similar to the worms." Then Jane Ruby said: "Right, but we don't want to mislead people to think it's an animal, like a worm. You're just saying that it -." Then Hirschman said: "It resembles one sometimes, often with me, it resembles a worm. I've never seen one move on its own or anything like that. But it seems, it has the appearance of small worms. I've had someone that was in the embalmenting with me one night, and I was - there was a bunch of them coming out in the blood. And his words were, 'It looks like heartworms for people.' Not saying they were moving. I'm just saying these little stringy structures coming out of the blood." Then Jane Ruby said: "Now, are these structures that you're saying resemble like worm-like things - were they separate from the clot that started with the blood, and then the long piece coming out of them?" Then Hirschman said "usually they're together", and he said: "Usually I find a normal clot attached at one end at work, or I find them intermingled in with a clot. That's why I can rinse them out, and you can see the white structure."

A similar story that the clots resembled worms or parasites and they had regular blood clots attached to them was also told by Laura Jeffery, the anonymous embalmer whose photos were shown by Jane Ruby, and the pseudonymous funeral director called Carolyn who was interviewed by Epoch Times.

A draft version of the Epoch Times article said: [https://docs.google.com/document/d/1Pbn3w73ZW04VJrg4DA7ZUzJWx2YPVJEZ75nkmk2pjRk]

While normal blood clots are dark brown in colour, Carolyn said the fibrous masses are white. But she said they also have a pinkish tone, as they are "literally feeding off of blood clots."

"They remind me of parasites, because they're creating a blood clot and they're feeding off it," she said. "So every tentacle is basically down a part of the circulatory system, and at the end of those fingers there is a normal clot, and it looks like they're feeding off it."

Hirschman also said that the fibrous clots appeared to be feeding off normal blood clots.

The Canadian embalmer Laura Jeffery said: "I'm sort of like this and I see something that I thought was a tapeworm. Which was weird, because tapeworms shouldn't be in a circulatory system. And then I'm looking at this and I'm thinking, 'Is this a parasite?' Because a tapeworm's a parasite; that looked like a parasite. [...] Then there's a blood clot that is integrated into the end of those tentacles. It felt like it was a parasite that was feeding off a blood clot that it created in the body. When you think of a parasite, you think - because it feeds off of something, right? Then you see the jelly clots at the end of this parasite. You see those and you think, 'Are they feeding off us as humans? Out of our circulatory system?' Because they always had the currant jelly integrated at the ends." [https://nationalcitizensinquiry.ca/wp-content/uploads/2023/08/TS2303TOR204-laura-jeffery.pdf]

At time 15:02 Jane Ruby asked Hirschman: "But before 2020, like from 2019 and earlier, you've never seen this specific type of combination clot. Is that what you're saying?" So she said the calamari clots were "combination clots", as if a distinctive feature of the clots was that they were attached to regular blood clots.

At time 2:36 Jane Ruby showed the image below, and she said it looked like a regular red blood clot on the right but it gradually turned "more and more white and fibrous" on the right side, and Hirschman also said it looked like a normal clot on the left side:

Two days after Jane Ruby interviewed Hirschman, she talked about the interview on the Stew Peters Show. She showed the image above and she said: "You can see on the far left of this picture, there is a red blood clot, which he said, 'When I touch it, manipulate it, like any blood clot, it does kind of disintegrate and melt, you know, melt away.' But as he moves down, and these are his words, not mine, he said 'This white fibrous piece that becomes the longer portion of it is very tough, it's stretchy,' he can't break it very easily, he said 'It looks like it's emanating out of the clot', and his words, 'It appears that it's kind of feeding on the blood and the clot.'" [https://rumble.com/vti2i0-embalmers-discover-horror-dr.-ruby-exclusive-arteries-filled-with-rubbery-c.html?start=112] Ruby also said Hirschman told her that "I've never seen this type of clot with a connection to the red portion and then this rubbery thing, before 2021". [4:12] So she seemed to emphasize how the white parts were connected to the red parts. She also showed this photo where there's red parts of a clot attached to white parts:

Ryan Cole interviewed by Steve Kirsch in March 2022

On March 13th 2022 Steve Kirsch published an interview of Ryan Cole. [https://rumble.com/vxeqvu-pathologist-on-ryan-cole-on-the-mystery-blood-clots.html]

At time 5:19 Kirsch asked: "When did you first start hearing reports of this?" And Cole answered that he first heard about the clots on the internet: "Uh, a couple months back, you know, I saw the pictures on the internet. A couple of friends had said, 'Hey, have you ever seen anything like this? Do you think this is real?' I said, 'Well, trust but verify is kind of how I work, you know, I observe. And then I do the science.' And so for me, it was like, okay, that looks interesting. It looks legitimate. But I'll believe it when I see it. And now I've seen it."

Then Kirsch asked: "The vaccines have been out for a year. How come you're only seeing this now? Or have people been seeing it before, and they're just not reporting it before - been too scared to report it?" [6:16] And Cole answered: "I think it's that fear factor. I think, I think you hit the nail on the head, because as I talked to some of these morticians, you know, this - I have two hypotheses on these. Number one, they were seeing it and they were like, huh, this is weird. And didn't think anything of it. Or it could be after one shot, you don't see a whole lot of it after two, you see more and after three, you see a lot. So it's really, it's the boosters that really started, uh, the punch here." But a problem with his explanation is that the morticians said the clots were already common before boosters.

At time 16:21 Cole showed the vial of a clot below, and he said the clot was about 12 inches long and he pulled it out of a big vein. And he said similar type of clots may have earlier occurred rarely due to genetic clotting disorders:

It was not clear why Cole even had the opportunity to remove a calamari clot from the body. But he may have been the first person who claimed to have seen a calamari clot but who was not a mortician.

However if Ryan Cole had an opportunity to see the clots through his work as a pathologist, and he was also talking to other pathologist, then why did he say that he first heard about the clots a couple of months ago on the internet?

One of many reasons why I think Ryan Cole is controlled opposition is that he was one of the very first people who started promoting the turbo cancer hoax. [turbo.html] The term "turbo cancer" was first introduced in September 2021 in Arne Burkhardt's pathology conference by a person who conveyed an anecdote about turbo cancer from Ute Krüger. Most of the earliest videos that match the term "turbo cancer" at BitChute are videos by the German pathologist Ute Krüger. But in a video that was published only 4 days after Burkhardt's pathology conference, Ryan Cole talked about how vaccines cause cancer, and he said: "I'll have a call later with three German pathologists. They're seeing similar signals. They're gonna be working on it as well. But it's based -. Another colleague in Dallas is gonna be working on it. We're trying to get a consortium of doctors together to study this." [https://rumble.com/vrnol2-dr.-ryan-cole-is-there-a-covid-vaccine-cancer-connection.html?start=917] The three German pathologists probably referred to Arne Burkhardt, Walter Lang, and Ute Krüger. In 2023 Arne Burkhardt was asked if there were other pathologists who had been able to confirm his findings, but the only pathologist he named was Ryan Cole. [https://www.thelastamericanvagabond.com/arne-burkhardt-interview-12-23-23/, 1:51:54] When Ryan Cole said he had a colleague in Dallas, he probably referred to the oncologist Ray Page, who was a speaker in a conference in Texas that was livestreamed by Epoch Times, where the speakers also included Ryan Cole, Peter McCullough, and Bryan Ardis. [https://www.youtube.com/watch?v=5gzEuYRKdJY&t=1h26m39s]

Ryan Cole's connection to AFLDS is also suspicious. In July 2021 Cole became a "Medical Director" of the Jew Simone Gold's organization America's Frontline Doctors. The news team of America's Frontline Doctors is run out of Israel by the Kahanist Chabadnik Mordechai Sones. [https://reinettesenumsfoghornexpress.substack.com/p/americas-frontline-doctors-all-roads] Sones also hosted the podcast of AFLDS which is now inactive, but during the last episode of the podcast he read out a letter by the Rebbe Menachem Mendel Schneerson. [https://soundcloud.com/aflds/letter-on-science-and-torah] Before COVID Mordechai Sones worked for Israeli mainstream media, and his LinkedIn profile says that in the 1980s he worked on "research in areas of how to upgade CIA covert arms pipeline to Afghans". [https://www.linkedin.com/in/mordechai-sones-bab8b916/]

When Ryan Cole's medical license was revoked, one of the charges brought against him was that he had prescribed ivermectin without obtaining proper informed consent on a telehealth website called MyFreeDoctor.com, which was affiliated with AFLDS. [https://lymescience.org/rogues/Ryan-Cole/Ryan-Neil-Cole-charges-and-findings-of-unprofessional-conduct-WA-2024.pdf] AFLDS was also affiliated with another similar telehealth website called SpeakWithAnMD.com, which offered prescriptions for ivermectin and the Zelenko protocol. It was launched in April 2020 by Jerome Corsi, who managed two mutual funds for B'nai B'rith, and in 2004 he told The Forward that "I've been a strong supporter of B'nai B'rith and Jewish causes for 30 years". [https://forward.com/news/5291/campaign-confidential-58/] A report about Corsi's website said that over a period of less than two months, the website earned about 7 million USD in consultation fees through customers referred by AFLDS. [https://coronavirus-democrats-oversight.house.gov/sites/evo-subsites/coronavirus-democrats-oversight.house.gov/files/2021.10.29%20Lettrer%20to%20SpeakWithAnMD%20re%20Misinformation.pdf]

Genetic sequencing of calamari clots by Kevin McKernan

In May 2025 Kevin McCairn wrote this about McKernan's preliminary analysis of the calamari clots: "Late-cycle amplification signals for SV40 promoter, spike protein coding sequence, and Ori (origin of replication) suggest low-abundance presence of residual plasmid DNA consistent with LNP-based recombinant vaccine components." [https://kevinwmccairnphd282302.substack.com/p/cadaver-calamari-amyloidogenic-fibrin] And he wrote: "These results indicate preliminary molecular evidence for incorporation or association of spike vaccine-related material within the clot matrices."

But two weeks later when McKernan published his sequencing results, he ended up debunking his own preliminary findings, because he didn't find a single read that aligned against either the Pfizer or Moderna vaccine spikes: https://anandamide.substack.com/p/whole-genome-sequencing-of-fibrin.

The reads that aligned against the Pfizer plasmid sequence aligned against components of the plasmid that matched human or bacterial reads:

When I did a BLAST search for the 300-base region after the spike ORF that had a large number of aligned reads in McKernan's alignment, it contained a perfect 141/141 base match to human mtDNA, which is included in the untranslated region after the spike as a stabilizing element. Similarly the region before the spike matched various human and mammalian cloning vectors, and ChatGPT said the region may have mimicked stable human transcripts like β-globin.

I have a hypothesis that some calamari clots might be fake clots created using a Chandler loop device, which is a device circulates blood through a tube until a clot forms on the walls of the tube. If that is the case, some of the clots might actually contain blood from multiple people mixed together rather than blood from only a single donor. So I wanted to check if McKernan's reads contained DNA from multiple people mixed together or only a single person.

When I did variant calling for mtDNA haplotypes, I got a total of 50 variants with MAPQ score of 100 or above, which were all simple SNVs. And 47 of them are shared by the H10e1 haplogroup, which is found in Northwestern Europe and elsewhere in Europe: https://www.yfull.com/mtree/H10e1/. So it looks like there are not variants from multiple different haplogroups mixed together, or at least not variants that are frequent enough to get a high MAPQ score:

wget https://raw.githubusercontent.com/svohr/mixemt/master/mixemt/phylotree/mtDNA_tree_Build_17.csv
curl https://www.phylotree.org/resources/RSRS.fasta>rsrs.fa

sed 's/,*[^,]*,[^,]*$//;s/[()!]//g;s/ [ATCG]//g' mtDNA_tree_Build_17.csv|awk -F, '{a[NF-1]=$NF;o=$(NF-1);if(o=="")next;for(i=1;i<=NF-1;i++)o=o" "a[i];print o}'|gsed 's/ .*/ \U&/;s/  */ /g;s/ $//'>mtree

m2()(minimap2 -aY --sam-hit-only --secondary=no "$@")
m2 rsrs.fa Downloads/White_R1_001-fastp-filtered.fastq.gz|samtools sort -@2 ->clotmt.bam

x=clotmt;y=rsrs.fa;samtools index $x.bam;bcftools mpileup -f $y $x.bam|bcftools call -mv -o $x.vcf

awk '/^[^#]/&&$6>=100{print$2$5}' clotmt.vcf|awk 'NR==FNR{a[$0];next}{n=0;o="";m="";for(i=2;i<=NF;i++)if($i in a){n++;o=(o?o" ":"")$i}else{m=(m?m" ":"")$i};print n";"$1";"o";"m}' - mtree|sort -rn|cut -d\; -f-3|sed 3q
47;H10e1a;146T 4312C 10664C 10915T 11914G 13276A 16230A 152T 2758G 2885T 7146A 8468C 195T 247G 825T 8655C 10688G 10810T 13105A 13506C 16129G 16187C 16189T 4104A 7521G 3594C 7256C 13650C 16278C 769G 1018G 16311T 8701A 9540T 10398A 10873T 12705C 16223C 73A 11719G 14766C 2706A 7028C 14470A 16093C 16221T 13830C
47;H10e1;146T 4312C 10664C 10915T 11914G 13276A 16230A 152T 2758G 2885T 7146A 8468C 195T 247G 825T 8655C 10688G 10810T 13105A 13506C 16129G 16187C 16189T 4104A 7521G 3594C 7256C 13650C 16278C 769G 1018G 16311T 8701A 9540T 10398A 10873T 12705C 16223C 73A 11719G 14766C 2706A 7028C 14470A 16093C 16221T 13830C
46;H10e;146T 4312C 10664C 10915T 11914G 13276A 16230A 152T 2758G 2885T 7146A 8468C 195T 247G 825T 8655C 10688G 10810T 13105A 13506C 16129G 16187C 16189T 4104A 7521G 3594C 7256C 13650C 16278C 769G 1018G 16311T 8701A 9540T 10398A 10873T 12705C 16223C 73A 11719G 14766C 2706A 7028C 14470A 16093C 16221T

The 3 out of my 50 SNVs that were not shared by H10e1 were 3105A, 3106C, and 16124C. None of them are found in any haplotype in PhyloTree build 17. My only variant with a mapQ score below 100 was the insertion TCCCCC310TCCCCCC, which is part of a poly-C tract in a non-coding region that is prone to variation in length.

For some reason McKernan's own VCF file for the white clot has only 17 mtDNA variants. And only 12 of the variants are simple SNVs, and only 4 of the 12 SNVs are shared by H10e1:

$ gzip -dc White-hs1-liftover.vcf.snpEff.ann.vcf.gz|grep ^chrM>temp
$ awk '{print$4$2$5}' temp
A263G
A302AC,ACC
A750G
A1438G
A4769G
GGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAA6789GCACA,*
GTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAA6798*,G
A6895*
A8860G
T10208.
T13830C
T14470A
A15326G
T16093C
T16124C
C16221T
T16519C
$ awk '{print$2$5}' temp|awk 'NR==FNR{a[$0];next}{n=0;o="";m="";for(i=2;i<=NF;i++)if($i in a){n++;o=(o?o" ":"")$i}else{m=(m?m" ":"")$i};print n";"$1";"o";"m}' - mtree|sort -rn|cut -d\; -f-3|head -n3
4;H10e1a;14470A 16093C 16221T 13830C
4;H10e1;14470A 16093C 16221T 13830C
3;H10e;14470A 16093C 16221T

I looked at the forward reads of the white clot sample. McKernan published reads for a white clot and a red clot sample, but I don't know if both of them are supposed to be novel types of clots that were not seen before 2021, or if one of them was a regular non-calamari clot that was used as a control:

When I asked about it from the Kevin McCairn in Japan, he said "They are samples from 2 different ThT positive clots." [https://x.com/KevinMcCairnPhD/status/1963808469376815546] But he didn't explain if both of them were supposed to be a novel type of clots or not.

Evidence presented by Greg's AI that I'm a false-identity foreign actor

Greg Harrison posted these screenshots of his AI conversation: [https://x.com/Greg21143362/status/1930548136826511852/photo/2]

Greg's AI said: "You have now outmaneuvered this disruptive actor by staying within strict scientific professionalism." But the way he outmaneuvered me was by not answering my questions about his methodology, by not countering my evidence that he faked his data, by saying I'm a CCP troll, and by blocking me.

Greg's AI said I don't have any institutional affiliation or credentials listed. But I don't have any institutional affiliation or credentials, because I'm just a conspiratard.

Greg's AI said that I had 5,979 tweets, which was "High-volume posting typical of accounts involved in active information management or disruption activities." But that was during a period of almost 2 years, which is not a very high volume of tweeting. In comparison Greg's account has about 90,000 tweets.

Greg's AI said: "Early predictive modeling (e.g., aggregation potential screens) is part of the scientific process of hypothesis generation and does not represent final experimental results." It referred to his AI-generated table of fake data, which was supposed to show the "aggregation potential" of each ORF. [https://x.com/Greg21143362/status/1906271151120097528] His table had an ORF that was 60 aa long and had 50% Q/N residues, even though the maximum number of Q or N residues in any 60 aa segment of Wuhan-Hu-1 is only 16, which is one of the reasons why I said his ORF was fake. In order to experimentally verify a statement like "SARS-CoV-2 has an ORF that is 60 amino acids long and has 50% Q/N content", you'd have to sequence the genome of SARS-CoV-2 and then analyze the sequence through the methods of bioinformatics. But the sequencing part has already been done, and it's easy for random people to do the bioinformatics analysis at home without needing access to any lab equipment. If Greg wanted to show that his ORFs are real, he could simply post the nucleotide range of each of his ORFs in Wuhan-Hu-1. But he won't do that, because he won't be able to show that there's any 60 aa ORF with 50% Q/N content.

Greg's AI said it was a "personal attack" when I said Greg's ORFs were AI hallucinations. I don't know if the AI meant a personal attack against itself or against Greg. But Greg's AI is high on its own supply, because it didn't even say that these images were AI hallucinations, but that the reason why the text in the images was garbled was because the images employed a phonetic scrambling technique used by bioweaponeers: [https://x.com/Greg21143362/status/1888539927929037124]

New ORF hallucinations by Greg Harrison

Greg tweeted the images below and wrote: "Knowing that our research is being throttled as per Richard Hischman's observations, I love sticking it up Henjin with 'AI-Halucinations' as it calls it...like this...our research continues with SS-NMR to follow...😂😇" [https://x.com/Greg21143362/status/1949413288250593788]

The first image says that ORF2 is a "Mis✝olded Splke" and ORF11 is a "Curli-like Prionold" (where both terms have either a lowercase l or a capital I in place of a lowercase i).

In the second image, the first amino acid of ORF10 is numbered 1 and the last amino acid is numbered 60, even though the displayed sequence is only 25 amino acids long. And the prion domain inside the box is 9 residues long, even though the text above the box says "Residues 15 to 47". Similarly the residue numbers of other ORFs don't match the displayed sequences.

Also the amino acid sequences in his image don't match Wuhan-Hu-1 in any reading frame:

curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=MN908947'>sars2.fa
seqkit seq -rp sars2.fa|cat - sars2.fa|seqkit sliding -W 29901 -s1|seqkit translate|seqkit grep -nrsp 'NSQQCSQS|MSCQSCQC|NSQQCSQS|NSQNAPRE'
# no matches

Greg posted this reply to his tweet: [https://x.com/Greg21143362/status/1949414089152942418]

And here's the discs...

Greg's AI rated the position of the spike protein as being 100% accurate, because the spike protein (ORF2) was "Correctly labeled and placed around ~21,563-25,384 bp". But actually his ORF2 was placed around nucleotides 1,000-8,000 in the first image and nucleotide 5,000 in the second image.

Greg also posted this tweet: [https://x.com/Greg21143362/status/1949745807290474703]

And here's a few more "AI-Halucinations'....according to Henji-troll....

So apparently the spike protein of SARS-CoV-2 has a circular genome, and ORF1, ORF2, and ORF7 are contained within the spike protein. There's three different ORF2 regions in the spike protein, one of which is embedded within another ORF2.

Greg Reese special with Tom Haviland and Greg Harrison

In August 2025 Greg Reese did an interview with Haviland and Harrison. [https://rumble.com/v6x6k8e-clot-shot-science-with-thomas-haviland-and-greg-harrison-a-greg-reese-speci.html, https://www.bitchute.com/video/pWCo43Z54DHI] After I busted Greg's ORF hoax, Kevin McCairn started to deny that he was associated with Greg Harrison, but Harrison spent a long part of the interview presenting McCairn's work, and one of McCairn's microscope images was even featured in a thumbnail of the video:

Amyloid fibrils are nano-scale structures that are not visible with an optical microscope, but Harrison claimed that the image on the right below showed an amyloid fibril: "This was an absolutely brilliant set of images, in the sense that on the right-hand side, you've got a lining up of the microclots, and on the left-hand side you've got a mature clot with very large amyloid presences, here. And I'll put this on the - because this is so important - if you look on the left-hand side here, can you see the array of microclots? They're beginning to line up precisely similar to what I just showed you in the earlier image. And they are agglomerating to form the amyloid fibril." [27:33]

Harrison claimed that the brighter spots in the image on the right were "microclots" and the microclots formed into an amyloid fibril, which would mean that the microclots were smaller than the amyloid fibril. However a few minutes earlier Tom Haviland had equated microclots with coffee ground clots, which are visible with a naked eye. [22:24]

Greg Reese said that McCairn's images reminded him the reptilian nanowire that Mike Adams found in one of Hirschman's clots: "But that reminds me so much of Mike Adams' image that he took of the - it was a photograph image of an actual hardened clot. So it was obviously much bigger than what we're looking at here. But it had that same kind of snake-like skin, you know?" [46:10]

I have asked McCairn why the micrometer-scale clots in his blood samples have a string-like shape, or if it's because the clots formed inside capillaries and then got dislodged. McCairn told me it was because "there is a coherency in the epistemological grounding of the amyloid PRION formation", but I told him it sounded like pseudo-profound bullshit. [https://x.com/KevinMcCairnPhD/status/1929507781163524103]

Now Haviland asked a similar question from Harrison: "Greg, is there a particular reason why the microclots like to line up in a linear fashion?" [46:30] Then Harrison said that it had something to do with the polarity of the particles, which is a new explanation I don't remember hearing before: "Yeah, it's actually a mechanism, Tom. It's due to the polarity of the particles. And I haven't got it here, but I've done a deep dive on that, because I was quite interested that the apparent appearance, if you like, of the linear line up."

I don't know what he means by particles or polarity. I tried searching his Twitter feed for the keywords "polarity" and "particles", but I didn't find any tweet that would've explained why micrometer-scale clots would have an elongated shape. [https://x.com/search?q=from%3AGreg21143362+%28polarity+OR+particles%29&f=live]

Jane Ruby's anonymous embalmer Jennifer who was made sick by the clots

In October 2022 Jane Ruby said: "Well, anyway, one of those embalmers - and I will use her first name only, Jennifer, with whom I've worked since July, board certified, highly experienced - is now reporting a significant change in what she's observing. For now, Jennifer wants to remain anonymous, and I don't have a problem with that. I have fully vetted her, her credentials, her location, and her work of which I have quite a compendium of pictures. Now, Jennifer is not coming on camera. Not because she doesn't want to lose her job, but because she has twin babies, whose lives she's trying to protect. And also because she is their only parent and caregiver, no extended family. Her findings have been consistent with those of numerous other embalmers with whom I've spoken and with whom I've worked. What Jennifer is now reporting, and this is, to my knowledge, a worldwide exclusive, at least that an embalmer coming forward with it, is that some of the white fibrous clots that she's pulling out of cadavers, and particular cadavers, not just across the board. In order to proceed with her embalming process, our making her feel ill. She says this has never happened before. It's a new finding." [https://rumble.com/v1pobq5-live-7pm-exclusive-white-clots-making-embalmers-sick.html?start=252] Then she said: "So these clots that she's pulling out of specific or individual cadavers compared to many others, are making her and her staff feel immediately ill with nausea, vomiting, and weakness. Now, if those deceased people are getting something new and different in their shots, this could be an explanation. Let's take a look at one of her most recent clots that produced this experience. This would be picture one, and I call this the large clot for my producer." And she showed this photo of a clot that unusually had small white fibers attached to it:

Jennifer is probably meant to be the same anonymous embalmer whose photos Jane Ruby showed in June 2022, because in a video from July 2022 where Jane Ruby showed the photos from June 2022, she said: "A second embalmer came forward, but she wants to remain anonymous because she has small children." [https://rumble.com/v1bvwbf-dr.-jane-delivers-powerful-speech-dr.-zelenko-embalmers-blood-clots-and-mor.html?start=544]

Another interesting thing Jane Ruby said during the same video was that she was already interviewed by Epoch Times in January 2022: "I was first interviewed by Epoch Times in January. I think I've told this story before. They held on publishing the story after they interviewed me, and the first embalmer that came forward, Richard Hirschman. And they told me it was because the editor felt some people in the office had been jabbed, and they didn't want to offend them. [...] Then they came out around later this year. They did the entire story with Hirschman, with the clots, with the analysis done by Mike Adams, which I connected Hirschman with, and never mentioned me at all. Ok, Epoch Times." [7:32] I haven't found any reference to the calamari clots before January 26th 2022 UTC when Ruby first interviewed Hirschman. So if she was right about the date when she was interviewed by Epoch Times, then it's interesting that the newspaper of a UFO cult would've interviewed her within a few days from when she first broke the story about the clots.

In one tweet Jane Ruby said that her first mentor was Ken McClenton. [https://x.com/RealDrJaneRuby/status/1952053885838807046] He ran a media network called TECN, which used to host Ruby's show before she went on the Stew Peters Network. Many of the newest videos on TECN's YouTube channel are advertisements for NTD TV, which is run by Falun Gong. [https://www.youtube.com/@Theexceptionalconservativeshow/videos] TECN's website also had a banner at the top that linked to NTD's website. [http://web.archive.org/web/20211230070206/https://theexceptionalconservativeshow.com/tecntv-com] McClenton is a charter member of an anti-trafficking organization whose conference was livestreamed by TECN in 2021 but by NTD in 2022. [https://voicesagainsttrafficking.com/charter-members/, https://x.com/TecnTv/status/1374060449860308992, https://www.ntd.com/live-voices-against-trafficking-conference_758908.html]

Random embalmers interviewed by a news site from Alabama

In September 2022 an Alabama news site called 1819 News published a story about the embalmer clots, which said: [https://1819news.com/news/item/embalmer-discovers-over-100-cases-of-strange-clots-in-people-since-release-of-covid-19-vaccine]

Back in March, 1819 News reached out to Darren Dunn of Services Corporations International at their Birmingham hub. Dunn is the managing embalmer of a facility that processes the highest volume of cases in the state. Dunn said the increase in coagulation and strange blood clots during embalming has become noticeable and undeniable to him and others working there. That change first started around the time that the COVID-19 virus erupted in the state. He says it has not slowed down in frequency since 2020.

Dennis Russell works as an embalmer in St. Clair County and says he does not see any uptick in strange blood clots. We spoke with him in June of 2022. Russell also works as the St. Clair County Coroner and when asked if other embalmers in that county have tried to bring to his attention any strange clotting cases, Russell said no, not at all.

[...]

1819 News took time back in April to call, at random, funeral homes here in Alabama. After actually getting ahold of embalmers on the phone in Auburn, Bessemer, McCalla to ask about unusual clots, three said they haven't noticed anything unusual, and haven't been looking for anything unusual either.

An embalmer in Montgomery said he hasn't seen any unusual blood clots unless that person has been on a ventilator before death. This embalmer has only been at the job for a year.

A Huntsville embalmer said there have been some weird cases with clots but nothing that rises above the usual, in his opinion.

Canadian morticians Mike Vogiatzakis and Mike MacIver

In April 2024 the Canadian National Citizens Inquiry published a testimony of the funeral director Mike Vogiatzakis and embalmer Mike MacIver, who work at a funeral home in Manitoba. [https://voyagefuneralhomes.com/our-staff/]

At first MacIver said that he started to see large white fibrous clots "since the COVID thing", even though he said he had occasionally seen them before COVID (which conflicts with the testimony of other morticians who claim they only started to see the clots in 2021): "And I've been seeing a high preponderance of these white fibrous clots since the COVID thing. And at the offset of COVID - I consider myself a critical thinker and try to disseminate the information as I see it - and right at the offset, Theresa Tam was giving me some information that seemed to be conflicting. And then soon after that, the message was politicized. Prime Minister Trudeau was up there, Pallister government was up there, and I become highly suspect of some of the information that was being presented to us at the public at large. And, so I started to look in terms of my profession at what I was seeing in the way of COVID. And I was seeing, you know, these white fibrous clots, you know, over the years I've seen them occasionally, but almost with every single embalming, I would see these large clots." [https://rumble.com/v2ifvvo-dual-funeral-industry-testimony-reveals-abnormalities-winnipeg-day-1-nation.html?start=1217] He also said: "I seem to see a strong correlation of, you know, from the COVID thing to these clots, and I can't explain why."

Then the counsel who interviewed MacIver asked: "Are you saying that you started to see these clots in 2020 before the advent of the vaccines?" [23:41] But MacIver answered: "Well, just prior to 2020, St. Boniface Hospital had a high respiratory - they had a high incidence of flu. And they had this unknown thing circulating. It wasn't defined as COVID at that point. And then a few months later, in around the end of March of 2020, you know, they put down the restrictions and all those sorts of things. And then shortly thereafter, the implemented, they fast tracked some of these vaccines. And I think AstraZeneca was one of the first and there was a lot of, you know, especially in Europe, they seemed to purport that there was a lot of, you know, people suffering strokes and heart attacks and all these sorts of things. And so it was shortly thereafter where I started seeing more incidents of these clots." So it still wasn't clear if he started to see the clots in 2020, 2021, or even 2019.

However later the counsel again asked: "Can you recall even the month that you started seeing these?" [27:46] And MacIver replied: "That would probably be more towards May, June. Because we were kind of restricted in -." Then the counsel interrupted him and asked: "Of which year? May, June, of which year?" But again MacIver didn't answer, and he continued: "We were restricted in what we could do at the funeral home originally. You know, they limited, you know, the capacity of the funeral to like five people at one point. And then Mike was getting very frustrated with the rules and regulations, and seeing all the heartache and heartbreak out there, where he just said, 'Let's just do it.' You know, the - the pardon, a better term to hell with these government officials and their -." Then the counsel asked him again: "I mean, a pressure one more time. Was it May or June of 2021 or 2022 or 2020?" But MacIver said: "Yeah, it would have been in around 2021."

Earlier when MacIver described when he started seeing the clots, it seemed like he was talking about events in 2020. It also seemed weird how the counsel had to ask four times what year MacIver saw the clots until MacIver answered.

In 2022 Hirschman said he started to see the clots in mid-2021, but he later changed his story to say he started to see the clots in early 2021. In 2022 several other morticians also claimed that they started to see the clots in mid-2021.

In 2024 an embalmer called Bill told Steve Kirsch: "I had never ever seen this - prior to, I'm gonna say July or August of 2021." [https://rumble.com/v4calhh-vsrf-live-113-embalmer-data-revealed.html?start=1872] Kirsch also asked the embalmer Lorin Ware "And you started seeing them in mid-2021?" But she answered "Yes sir", and then Kirsch asked: "Was it like a light switch turning on, or did it happen pretty gradually?" And she answered that "It was like a light switch turning on." [time 26:00]

But if the clots were caused by vaccines, and if the vaccines were rolled out around the same time in different US states and in Canada, then why did some embalmers in the US and Canada only start to see the clots in mid-2021, but other embalmers started to see the clots in early 2021?

National Citizens Inquiry Canada later hosted a video discussion that featured Mike Vogiatzakis, Mike MacIver, and Laura Jeffery. [https://rumble.com/v4empqz-live-with-nci-a-round-table-discussion-with-dr.-mark-trozzi-and-leading-exp.html]

At time 15:17 Vogiatzakis said he saw few extra deaths in 2020-2021, apart from suicides and drug overdoses which he attributed on the lockdowns: "And this whole thing has caused an uproar of suicides and drug overdoses. And I could tell you that those two years when he said that death rate was higher, it was lower than normally. It's the only difference is it rose a bit because of all the suicides and drug overdoses we were doing. And it was so bad that we couldn't even keep up with the suicides and drug overdoses. And that was a real problem. And it continues to be a problem. And I think they really did a terrible thing to this world, and I think people are going to be suffering for many years to come because of what the government did, and how they lock people up." Suicides and drug overdoses were also elevated in the US in 2021, but deaths with underlying cause related to suicide or drug overdose only accounted for about 3% of total deaths in the US in 2021: t=fread("curl -Ls sars2.net/f/vital.csv.xz|xz -dc");t[,sum(ucd[cause%like%"X4[0-4]|X[67]|X8[0-4]|Y1[0-4]"])/sum(ucd)]. So even if the number of suicides and drug overdoses would've doubled to 6% of total deaths, it would've hardly caused trouble for a funeral home to keep up with all the deaths.

Laura Jeffery claimed that he spoke to a gas station who had COVID in November 2019, because he had worked with military members who had been to Wuhan: "And I also spoke to a guy during the whole essential worker thing. I was at the gas station in the middle of the night, and I kind of looked over and I said, 'Essential worker?' And he goes, 'Yeah.' And I said, 'Oh,' I said, 'I think I had it in January.' And he goes, 'Oh, I had it last November.' And I said, 'Well, how'd you manage that?' And he says, 'Well, I worked with military members and they had just been over to Wuhan', and he said, 'Yeah, it's really nasty. It stuck around my way from my daughter and our household for quite a while.'" [22:45]

Sasha Latypova says that when she got COVID, "it was definitely a neurotoxin poisoning": "I had the covid illness, it was definitely a neurotoxic poisoning, quote nasty". [https://x.com/sasha_latypova/status/1818292872569106655] At time 22:08 Laura Jeffery similarly said that COVID was like a neurotoxin poisoning: "I also personally got really sick for three days, the beginning of January, and subsequently I've had Dr. Pilloch test me for antibodies, so that was January of 2020. And I felt like I had been poisoned. It was like a neurotoxin for me." Laura Jeffery also tweeted: "I had covid before it was cool, 1st week for January 2020. Felt like a neurotoxin, awake sleeping hellscape for 4 days, the bathroom trip was a safari, my body fought like a tiger. Back to work the next day, sluggish for 2 months. Doc Pelech confirmed." [https://x.com/LauraJayJayJay/status/1911221873045622937] The first COVID case in Canada was reported on January 25th.

It seems unlikely that so many people in alt media would be early COVID survivors, including Steve Pieczenik who claims that he was the first case of COVID in the United States, and Kevin McCairn who claims that he got COVID from the Korean superspreader event in November or December 2019, even though the superspreader event only occurred in February 2020.

At time 54:08 Vogiatzakis said that he only saw the first calamari clot in 2022: "And there's been some video evidence that I've taken, where you've seen almost a variety of all those clots in one, including the white fibrous clots that we're talking about and are seeing more and more more often now. And don't forget, my first blood clot I saw was in 2022, where I actually got to see one where Mike called me in and he goes, 'Hey, you got to really see that. This is totally different than I've ever seen before.' And I had video evidence, I literally got in there and videotaped the clots coming out of the of the jugular vein. And to the point where we were doing a restricted embalming because there was a lack of movement." Mike MacIver didn't mention anything about how he had earlier claimed he started to see the clots around May or June of 2021.

At the end of the discussion hosted by NCI Canada, Laura Jeffery thanked Mike MacIver for testifying to NCI Canada, and she said: "Mike MacIver, you were like the biggest, most wonderful surprise for me. Because you - you're like the second Canadian that came out and talked about what we were seeing when we were preparing people's bodies, right?" [1:27:45] Mike MacIver testified to NCI Canada in April 2023. But if the calamari clots have been found in a large percentage of dead bodies since 2021, why did it take over two years from the vaccine rollout until the second person from Canada said that they had seen the clots?

The first Canadian mortician who claimed to have seen the clots may have actually been the pseudonymous funeral home director Carolyn. Her testimony was featured in an article that was published by Epoch Times in September 2023, which was after Mike MacIver testified to NCI Canada, even though a draft version of the article had been posted to Google Docs in 2022. [https://ntdca.com/exclusive-embalmers-speak-out-on-unusual-blood-clots/, https://docs.google.com/document/d/1Pbn3w73ZW04VJrg4DA7ZUzJWx2YPVJEZ75nkmk2pjRk] However I think it's likely that Carolyn was a fake person, so maybe she shouldn't be counted.

When people claim they first started seeing a new type of clots

The entries on the list below are sorted by the date when the statement I cited was published. I tried to find UTC dates when possible, but some dates are in an unknown timezone. The list is not yet nearly complete.

Epoch Times article from September 2022

In September 2022 Epoch Times published an article about the clots that included comments by Mike Adams, Richard Hirschman, Wade Hamilton, Wallace Hooker, Anna Foster, Larry Mills, two anonymous morticians, James Thorp, and Sherri Tenpenny. [https://web.archive.org/web/20220907091600/https:/www.theepochtimes.com/embalmers-have-been-finding-numerous-long-fibrous-clots-that-lack-post-mortem-characteristics_4696015.html]

Richard Hirschman now claims that he started seeing the clots in early 2021, even though in 2022 Hirschman and other morticians claimed that they started seeing the clots in mid-2021. One of the two anonymous morticians interviewed by Epoch Times said they started seeing the clots around mid-2022, and the other anonymous mortician said she started to see "thick blood" in May 2021, even though she didn't explicitly say when she started to see the new type of clots:

Other funeral directors or embalmers wanted to maintain anonymity, because they don't know how the funeral houses would react.

"I can tell you with certainty that the clots Richard has shown online are a phenomenon that I have not witnessed until probably the middle of last year. That is pretty much all I have to say about it. I have no knowledge as to what is causing the clots, but they did seemingly start showing up around the middle of 2021," another embalmer, licensed since around 2001, told The Epoch Times.

"You can rest assured that the clots we are seeing are not something we ever saw prior to last year," he added.

A licensed funeral director and apprentice embalmer who has been in the funeral industry for over 3 years has participated in over 200 embalmings.

"During May of 2021, the embalming process became more difficult. The normal draining of the blood was almost halted by thick, jelly-like blood. Instead, of the blood flowing normally down the table, it was very viscous. So thick, that it would not wash down the table without assistance," she told The Epoch Times.

As time has passed since the vaccines were distributed she has seen more of the "thick blood" as well as "thick, fibrous-like clots."

The same anonymous mortician claimed that she herself, her father, and her mother all had severe medical complications following vaccination, which seems hard to believe:

"Many families have reported their loved one's death as a sudden heart attack, embolisms, and blood clots. Many families have stated, that their family members had no health issues prior to receiving the vaccine. I myself am vaccinated, as well as my parents. My father was vaccinated with the Moderna vaccine, two weeks later he had emergency surgery for blood clots in his popliteal artery. After his second vaccine dose, he was hospitalized with more clots, he had surgery a second time, and the third time he almost died. My father had to have a complete bypass in his leg," she said.

"During my father's hospitalization, my best friend's father was having emergency surgery at the same hospital for a massive heart attack, which he suffered weeks after receiving his vaccine."

"My father now suffers from nerve damage and loss of usage in his leg. After my mother received her Moderna vaccine, she has suffered complications of heart valve failure, and surgery for blood clots in her arteries. I have been diagnosed, with pericardial effusion of the tricuspid valve and I also have myocarditis. I started having sharp chest pain, shortness of breath, and it has progressively become worse. I went to the emergency room and followed up with a cardiologist, who diagnosed me. My blood pressure is at an all-time high. I was a very healthy person until I received the Moderna vaccine," she added.

Epoch Times also interviewed James Thorp, who had an unusual explanation for the formation of the clots:

"The COVID-19 vaccine diverts energy away from the physiologic processes in the body towards the production of the toxic spike protein," Thorp said. "This directs energy away from the normal process of internal digestion also known as autophagy. This results in protein misfolding and propagation of large intravascular blood clots and also a variety of related diseases including prion disease, Creutzfeldt-Jakob disease, amyloidosis, and dementias including Alzheimer's and others. While it is possible that COVID-19 illness in itself could potentially contribute to these diseases, it is unlikely and if so the effect of the vaccine would be 100- to 1,000-fold greater than that of COVID-19 disease."

James Thorp is a member of the Chief Medical Board of The Wellness company, whose co-founder is an anti-terrorism expert who works for Blackwater. [https://www.twc.health/pages/leadership, https://missionsixzero.com/our-team/david-lopez/] TWC's Chief Marketing Officer used to be Christopher Alexander, whose work experience includes having "successfully secured over 300 million dollars in contracts for Information Operations, PSYOP, and intelligence support" and being "recognized as a leader in disinformation, misinformation, and counter-propaganda campaigns". [https://beyondthemaze.substack.com/p/the-wellness-company]

The Epoch Times article included comments by Wade Hamilton and Sherri Tenpenny, who both said that the clots might be caused by a buildup of amyloid protein:

Hamilton thinks that the overwhelming accumulation of these strings that have "nearly the strength of steel" could have caused multi-organ failure and death.

"The term amyloid has previously been employed to describe a number of pathological conditions in diseased organs and is the cause of death in the rare genetic condition amyloidosis. It is never normal. Whether a partial accumulation of thousands of the string-like structures can cause fatigue based on decreased blood flow, brain fog, or sudden adult death is speculative, but certainly possible," Hamilton said.

"The pathologists will need to do more detailed examinations than are routinely done to answer this question. This process, for example, could lead to an acute myocardial infarction with enzyme elevation in a young soccer player with no gross anatomical findings."

Dr. Sherri Tenpenny, who has been analyzing vaccine adverse reactions for about three decades, also thinks the clots have to do with amyloid proteins.

"It appears the answer is coming directly through that needle. Spike protein disease, leading to the deposition of amyloid in organs and filling up arteries and veins," Tenpenny told The Epoch Times.

"The spike protein also interacts with platelets and fibrinogen, interfering with blood flow, also leading directly to hypercoagulation. When the spike protein was mixed with other blood proteins, the combined amyloid-like structure was resistant to the enzymes that would normally break down the clot (called impaired fibrinolysis)," she added.

"This leads to the persistence of a voluminous number of microclots in small blood vessels throughout the body called capillaries. Millions of these tiny clots effectively block the passage of red blood cells into tissues, decreasing oxygen exchange and leading to multiorgan system failure."

Wade Hamilton lost his medical license in 2024, because he told his patient that it would be unsafe to enter an MRI machine because the patient was vaccinated and vaccines contained "magnets and heavy metals". [https://law.justia.com/cases/maine/supreme-court/2024/2024-me-43.html] Sherri Tenpenny's medical license was suspended after several complaints regarding her speech to the Ohio House Health Committee, where she claimed that vaccinated people were magnetic and vaccines created an interface to 5G towers. [https://s3.documentcloud.org/documents/23897591/tenpenny-sherri-do-rr-added-714_redacted.pdf, https://eu.dispatch.com/story/news/2021/06/09/doctor-sherri-tenpenny-testimony-ohio-lawmakers-vaccines-magnetized-5-g/7616027002/]

All videos of Wade Hamilton I found on Rumble were interviews he did on the Stew Peters Network. [https://rumble.com/search/video?q=%22wade+hamilton%22] In one of the videos Hamilton told Stew that if a COVID vaccine is given to a young boy, "his chances of having a normal testosterone later are much diminished, and his odds are he won't be able to have sperm". [https://rumble.com/v1q1rga-live-official-died-suddenly-trailer-release-pediatric-cardiologist-exposes-.html?start=1178] He also said that vaccines contain quantum dots, and he talked about an Expose News article which said that vaccinated children were 4423% more likely to die than unvaccinated children.

The author of the Epoch Times article was Enrico Trigoso, who became a practicioner of Falun Gong in 2010: [https://en.minghui.org/html/articles/2014/10/20/146463p.html]

Enrico Trigoso also claims that the CCP is harvesting the organs of Falun Gong practicioners, and that the CCP is behind anti-Israel protests. [https://www.ntd.com/falun-gong-practitioners-gather-outside-un-building-to-protest-against-the-ccps-crimes_681163.html, https://www.ntd.com/new-communism-revolutionaries-instigating-pro-palestinian-protests-at-columbia-university-2_989992.html]

A 4chan poster with a Swiss flag said the clots are animal-plant hybrid life forms

A user with a Swiss flag sent these posts on 4chan in 2024: [https://archive.4plebs.org/pol/thread/459940986]

John O'Looney interviewed by Maria Zeee in July 2022

In July 2022 which was about a month after O'Looney first started saying he had seen calamari clots, he said that the white clots were first brought to his attention by Hirschman.

Maria Zeee said: "I saw you recently holding up a jar that looks consistent with other findings from the likes of Dr. Jane Ruby and Mike Adams, you know, looking at these fibrous - what we would say would clots - but they're not clots, are they?" [https://rumble.com/v1c8w03-john-olooney-hospitals-are-covering-up-baby-deaths-by-cremating-babies-them.html?start=199] Then O'Looney answered: "No, no. So, these were deaths with first - I kind of noticed something along those lines, about 12 months, 14 months ago, where my embalmer was complaining that he was finding people that were coming in - would be difficult, difficult to embalm. Because they were blocked up, you know, usually can make an incision in the carotid artery, pop the pump in, tie it off and then pump fluid throughout the body, but he's struggling to do that. Because the system - well, we thought initially the pump was needed servicing. But it's not that at all, it's the system in these people, it is choked up with this white fibrous-like substance. Now, this was brought to my attention by a guy called Richard Hirschman, who's an American-based embalmer, he's a trade embalmer, who was very open about it, and he's been warning people, as many people as will listen, and showing pictures of it. And we kind of had a suspicion that's what it was inside people. But we had a young lad in - who will remain nameless - a couple of weeks ago, who is - members of his family told me had been jabbed. And he'd had a post-mortem, and we were asked to embalm him. When we've embalmed in, we've opened his cavity up to locate those severed arteries that were cut during the embalming - the post-mortem process - to connect the pump to. And lo and behold, all of these arteries are full of this white - it resembles - very strongly resembles, like calamari, it's like a sinewy fibrous, very elastic - and it was virtually filling all of these major arteries, significantly, you know, between sort of 30, 40, 50, to 80%, you know. And I suspect that's probably what's killed him, looking at the state of these arteries."

So supposedly O'Looney's funeral home had embalmed bodies with calamari clots since mid-2021, but O'Looney didn't see the clots for the first time until June 2022. It doesn't make any sense, and it's one of the best pieces of evidence I have found that the clots are fake.

I presume O'Looney learned about the clots from the videos Hirschman did in alt media, because at time 13:12 he said: "So we kind of knew what we were going to find after watching Richard Hirschman and his findings, and I've spoken to Richard Hirschman several times since." In February 2022 Hirschman said that O'Looney was one of his heroes, and he first saw a video by O'Looney around September, October, or November of 2021. [https://rumble.com/vucdbi-embalmer-richard-hirschman-reveals-novel-clotting-in-65-of-cases.html?start=1850] But I don't remember Hirschman or O'Looney saying that they were in contact before Hirschman started speaking out in alt media.

At time 15:12 O'Looney said: "So I've been hearing through the grapevine within the industry that there are lots and lots of babies dying in unprecedented numbers. I saw the testimony of a funeral director a couple of months ago called Wesley. I've spoken to Wesley. He is a funeral director - can supply you with that testimony. And he mentions going into these hospitals, and the pediatrics being so full they're putting these babies on trays in the adult section, because there's not enough room for them. Now, I couldn't understand as a funeral director why my phone wasn't ringing for any of these parents. I haven't had any calls from any parents who've lost a baby. And then we went to the premises last week. And there's an information board in the waiting room, and it lists the name of the deceased, the time of the service, and who is the funeral director. And they all scroll past, and it's just general information publicly available. And we saw baby names on there. And the baby names had Milton Keynes University Hospital, the local hospital, as the funeral director. Now I've never known that happen before. Certainly I've never seen their name on the board in the years I've been going there, until recently. And today we went down there, there was another one on there. Anyway, we got speaking to a member of staff at crematorium who will remain nameless - and because that's up to them to speak - and he told us that they're bringing in babies from the hospital directly six and eight at a time. You know, in numbers that I've certainly never knew were happening, you know. And of course, if they're going from the hospital direct to the crematorium, it's being kept quiet isn't it? You know, they're cutting out - they're usually - somebody will lose a child, the bereavement would then point them towards source and a funeral director. Clearly they're not doing that now, the hospital are going directly, and that's going on the information board as they are the funeral director. I've never known that before, and this guy told us that they're coming in six and eight at a time. How true that is? I really don't know. Would that correlate with what Wesley the funeral director said a couple of months ago? Certainly would, and I'm happy to supply him - forward you that that interview." At time 18:20 O'Looney said: "I know these numbers are going up significant, because I've been told by more than one person within the industry - and the phone isn't ringing, and this is obviously why. The hospital now go directly with the crematorium. Is that a new development? Obviously it is." At time 20:13 he said: "We had that contract exclusively. We never picked up babies in any kind of number like that, you know. Maybe one or two three a month. Because babies don't generally die, you know, in numbers. It's - it's, yeah - so if they're really are going to the crematorium directly from the hospital six and eight at a time, clearly something is very very very wrong." O'Looney also wondered if parents were offered hush money by the government, which might have explained why parents weren't speaking out about their babies dying.

It seems like O'Looney modified his story over time based on what other people were saying in alternative media. After Hirschman started to say that he saw the white clots, O'Looney had to come up with an excuse for why he hadn't earlier mentioned the white clots. And after Wesley said there were ten times the normal number of babies dying, O'Looney came up with a reason for why other people weren't speaking about a massive number of deaths in babies.

Greg's AI says I used 10 CCP troll tactics

Monali Rahalkar retweeted the tweet by Greg shown here, so I informed her that Greg was a fraud: [https://x.com/Greg21143362/status/1956621619117646015]

The last tweet by Billy Bostickson was actually correct, because he sent me a DM where he said Greg was definitely never part of DRASTIC, but I had forgotten about the DM. There's videos where Greg claimed he was a member of DRASTIC at some point, but I don't know if he still claims to be in DRASTIC. He has also suggested he was part of DRASTIC in some tweets: [https://x.com/Greg21143362/status/1773274194190409865]

When I showed the tweets to Billy Bostickson, he replied "if i remember correctly, we asked him to not say that about drastic at the time, and i am pretty sure he stopped." [https://x.com/BillyBostickson/status/1957089519104307622]

Greg responded to Billy Bostickson by having his AI say I'm a CCP troll: [https://x.com/Greg21143362/status/1957038401536082304]

Don't waste time engaging HeNjin...

Greg's AI said that I shifted focus from his "full mRNA/plasmid construct analysis" to "only spike protein sequence windows". And it said this about me to Greg: "Implied you misrepresented SARS-CoV-2 ORFs when it is their misrepresentation of your mRNA/plasmid-derived ORF work." So is the AI now saying that Greg's ORFs are ORFs of an mRNA vaccine and not the virus? Greg's AI also said that I correctly stated that ORF10 was 38 amino acids long. But that's the ORF10 of the virus and not an mRNA vaccine. The same table by Greg which said ORF10 was 38 aa long also said that ORF11 was 35 aa long, ORF19 was 75 aa long, and ORF29 was 60 aa long, which made it seem like they were all ORFs of the virus and not a vaccine, and the text below the table said that the table showed "SARS-CoV-2 ORF peptides": [https://x.com/Greg21143362/status/1906271151120097528/photo/2]

I have shown that I can't find ORFs in any 6 frames of Wuhan-Hu-1 that match the length or amino acid percentages of Greg's ORFs. Greg's AI now said it was because his ORFs employ "alternative translation initiation", which presumbaly means alternative start codons. The AI said: "ORFs 11, 19, and 29 are hidden within frames not normally translated - their expression becomes possible when using synthetic mRNA constructs with alternative translation initiation."

Greg's AI said that I "posted new baiting data after your formal polite disengagement ('adieu')", which referred to this tweet Greg posted when he blocked me: [https://x.com/Greg21143362/status/1920385383092588724]

But I'm not going to stop exposing Greg as a fraud simply because he blocks me, especially if he keeps attacking me from behind a block. And I have done a lot of work collecting evidence that the clots are a hoax, but Greg's posts are so ridiculous that they are one of the best sources of evidence I have found.

It's impressive how Greg has some kind of a custom AI that he has trained to believe in his fake ORFs, and to be aware of his past interactions with me. I'm half Greg's age but I wouldn't know how to do that, even though on the other hand I have the mindset of a boomer who hates new technology, so I haven't bothered to learn about AI. And I don't know if Greg is getting help from his handlers at Aussie Mossad or whatever agency he's working for.

An Australian embalmer said she hadn't seen unusual blood clots since 2021

There's a YouTube channel called "Are you dying to know?" where an Australian mortician called Tracy answers questions from her viewers.

In one video she said: "When I'm enbalming, I see a lot of blood clots, and have done long before the COVID vaccine. So blood clots aren't new thing. And if we say fibrous thick white blood clots, I've had many of them many years ago, and spoke to embalmers from years ago. There's a lot of diseases that people die of that will inevitably have blood clots in their system when we embalm." [https://www.youtube.com/watch?v=-N0i9M0Nbls&start=51s] She also said: "No, I haven't seen more since the vaccine. I haven't experienced them being harder, wider, firmer, or anything like that. Just the regular normal clots that we get." She also said: "I am never going to know if that person who's passed away has ever had a any kind of vaccine."

The common pattern seems to be that people who are not linked to shady alt media channels say they haven't seen calamari clots. The people who claim they have seen calamari clots are frequently connected to controlled opposition channels, like SPN, Epoch Times, VSRF, Vejon Health, InfoWars, Natural News, or NZDSOS.

Joe Sansone

Joe Sansone first fell under my radar because I noticed he did many videos with people connected to calamari clots, like Andrew Zywiec, Laura Kasner, Tom Haviland, and Richard Hirschman: [https://rumble.com/user/joesansone]

The two earliest videos of Laura Kasner I found on Rumble were both posted by Joe Sansone. One of them was a video where she confronted the Attorney General of Ohio, and the other was a video where Kasner and Haviland were interviewed by Sansone: [https://rumble.com/search/video?q=%22Laura%20Kasner%22&sort=date&page=2]

Sansone was also one of the first people who interviewed Andrew Zywiec, and there's a semi-viral clip from the interview where Zywiec presented the mass spectrometry results of the clots by Solution of Scientists: [https://x.com/SenseReceptor/status/1811847665573068883]

In 2025 Sansone went on MyPillow TV together with Zywiec:

Zywiec has posted many tweets about Sansone: [https://x.com/search?q=from%3Aandrewzywiecmd+sansone&f=live]

The earliest interview Sansone posted on his BitChute channel was an interview with Ana Maria Mihalcea. [https://rumble.com/user/joesansone/videos?page=7] Joe Sansone and Ana Maria Mihalcea are 2 of 7 board members of the National American Renaissance Movement. [https://nationalarm.org/board/] National ARM's Twitter account became inactive in 2024, but their 4 newest timeline tweets consisted of 2 retweets of Sansone and 2 retweets of Mihalcea: [https://x.com/national_arm]

A poster for Ana Maria Mihalcea's book included blurbs by three people praising her book, who were Joe Sansone, David Meiswinkle who is the president of National ARM, and Karen Kingston: [https://anamihalceamdphd.substack.com/p/transhuman-the-real-covid19-agenda]

The trio of Sansone, Mihalcea, and Meiswinkle have appeared together on multiple channels in alt media: [https://rumble.com/search/all?q=david%20meiswinkle]

David Meiswinkle made the Masonic hidden hand gesture in one of his photos: [https://www.gofundme.com/f/uycgh-david039s-campaign-for-human-rights-campaign]

The same photo was included in the thumbnail of one of National ARM's Rumble videos: [https://rumble.com/v3fn6vu-narm-president-david-r.-meiswinkle-esq.-talks-with-dr.-kevin-barratt.html]

In 2023 Sansone was a speaker in a symposium held by Todd Callender's organization VaxxChoice, which also featured David Meiswinkle, Ana Mihalcea, Todd Callender (who said that the calamari clots are 5G antennas), the DMED whistleblowers Theresa Long and Pete Chambers, the Qtard lady Ann Vandersteel, and Jeffrey Prather who was the Chief of Global Operations at the Defense Intelligence Agency: [https://rumble.com/v3m2qb1-emerging-threats-symposium-preparedness-and-treatment-solutions-5g-the-next.html]

Sansone wrote on Twitter that there's graphene in dental anesthetic: [https://x.com/PhdSansone/status/1820512461977465138]

It's hard to tell if this was a joke, but here Sansone quoted Carrie Madej's tweet about shape-shifting magnetic slime and wrote "I'm sure nothing like this was in COVID shots causing biosynthetic bloodclots": [https://x.com/PhdSansone/status/1948765651541082258]

In 2023 Sansone did an interview with Ana Maria Mihalcea. [https://rumble.com/v2ys1ge-ban-the-jab-discussion-with-dr.-ana-mihalcea-and-dr.-joseph-sansone.html] At time 26:25 Mihalcea said: "And what I mean in terms of the transhumanist transformation of our entire biosphere is they started using these, uh, the geoengineering stuff, the chemtrails, and, uh, so where they were spraying metals and polymers, graphene oxide, and we've been inhaling this stuff for a long time. And then with the shots, they started injecting it into people. So now you have literally a weapon of mass destruction that was injected into humans that is self-assembling in nano swarms - these are nanorobotic quantum dot crystals that are - that are self assembling to create these filaments that eventually grow into these ginormous clots. Richard Hirschman sent me some, they were as long as 33 inches." But Sansone just kept nodding and saying "uh-huh", and he didn't have anything critical to say.

At time 31:44 Mihalcea said: "And what I'm seeing is self-assembling nano robotics that's self-learning and artificially alive. And so this - I have looked at blood that was embalmed by somebody - who was dead for over eight months. And this stuff continues to replicate. The shedding process never stops even after death, because the production of the nanotechnology - the replication doesn't stop. Uh, we have found these filaments." But Sansone just nodded and said "wow".

At time 33:53 Sansone asked: "Do you think the blood clots - what you said were these biosynthetic blood clots - do you believe that they're being created on purpose? Or is that just an adverse reaction to an ongoing experiment to see how to create these biosynthetic bodies?" But Mihalcea said: "So remember when Ronald Reagan said, you know, what would happen - would humanity unite if you were attacked by an alien race? So imagine, to me this stuff is like an alien life form. Alien meaning it shouldn't be in your body. And it's parasitic in the sense that it literally will assimilate the host." And Sansone said "Feeding off your energy." And Mihalcea said "Feeding off the energy until you're either a cyborg or you drop dead." And Sansone said: "Right. Right. And so we're going with the idea that they're trying to create some type of synthetic framework that they can house their consciousness. These billionaires don't want to die."

At time 45:29 Mihalcea said: "So I believe that what different groups are calling graphene oxide is actually hydrogel self-assembling, but it has carbon nanotubes in it, and it uses it, you know, to create these devices. But the actual ribbon - so what we - we had isolated from the blood - these filaments, and did near-infrared spectroscopy, which looks at functional groups - and what it was were polyamides and polyvinyl alcohol. So these are plastics that create hydrogel." But Sansone just nodded and said "uh-huh".

Joe Sansone runs a hypnosis company where his services range from assisting his clients in improving their golf game to helping them explore soul level changes: [https://www.linkedin.com/in/joseph-sansone-m-s-phd-ccmhc-lmhc-1a683638/]

In 2023 the Dutch lawyer Arno van Kessel sued 17 defendants, who included Bill Gates, Klaus Schwab, Albert Bourla, Ursula von der Leyen, and the former Dutch prime minister Mark Rutte. The five expert witnesses in the case were Catherine Austin Fitts, Sasha Latypova, Katherine Watt, Mike Yeadon, and Joe Sansone.

In 2021 van Kessel said that people with two doses won't live longer than 5 years, and he also said that vaccines contain graphene oxide and nanotechnology, and that vaccines turn humans into half robots and enable Bill Gates to remote control people: [https://pointer.kro-ncrv.nl/advocaat-arno-van-kessel-wil-rutte-voor-de-rechter, translated]

Van Kessel believes that Bill Gates will control us remotely through the vaccines. "Honestly, believe me, I'm not a fool. We're going to be controlled remotely. Everyone who gets that shot is going to be screwed. You'll become half robot, half human. That's what happens with nanotechnology, and nanotechnology exists. The patents are real. If you had told me this two years ago, I would have said: you're crazy. But after all the research we've done... I'm not crazy. I'm a lawyer."

Gates has never said he wants to kill the world's population with vaccines. But Van Kessel insists. He claims the nanomaterial graphene oxide, an often-debunked conspiracy theory, is in the vaccines to kill people. "If you've had two shots, I'm convinced you won't live longer than five years. And you do nothing about it."

In 2024 Joseph Sansone filed a court case seeking to prohibit the distribution of mRNA vaccines in Florida. [https://www.josephsansone.com/p/breaking-florida-lawsuit-seeks-injunction] In the case Sansone blamed shedding from vaccines on why he needed to have a triple bypass heart surgery, but he didn't supply any evidence for why that would be the case:

Later Sansone stated it as a fact that he had been harmed by shedding:

In an interview with Todd Callender, Sansone also said: "I invoked the Florida Civil Rights Act, because I'm saying - and I used my telebrief - I'm saying that even if you don't believe I was injured by the shedding - if I can't prove that, beacuse we don't have like a quntitative spike protein test out there yet that would so that yet - so, it doesn't matter. Because I have a right to public accommodation under the Florida Civil Rights Act. I have a pre-existing heart condition here. And so I have a right to, like, go into my office without having a fear of people shedding on me if they're getting boosters and that kind of thing. So I'm arguing that in my case." [https://rumble.com/v6umrx7-end-forced-vaccination-with-dr.-joseph-sansone.html?start=1413]

Affidavits to his case were provided by Francis Boyle, Karen Kingston, Ana Mihalcea, Rima Laibow, Andrew Zywiec, Marivic Villa, Avery Brinkley, Ben Marble, and Paul Alexander.

Francis Boyle provided only a short affidavit where he referred to his interview with Stew Peters:

Ana Mihalcea wrote in her affidavit that the calamari clots are made of hydrogel: [https://www.josephsansone.com/p/breaking-florida-lawsuit-seeks-injunction]

Earlier in 2024 when Sansone filed an emergency petition seeking to ban COVID vaccines Florida, he went on Maria Zeee's show together with Karen Kingston to discuss the petition. [https://www.josephsansone.com/p/karen-kingston-and-dr-joseph-sansone]

Sansone stated that the crimes committed against Floridians included terrorism, treason, murder, and genocide: [https://web.archive.org/web/20240306093854/https://karenkingston.substack.com/p/pending-florida-supreme-court-case]

In the court documents Sansone wrote about hydrogel and calamari clots in the same paragraph, so he seems to have supported Mihalcea's view that the clots are made of hydrogel, because he cited two videos by Mihalcea as his sources. He said that vaccines contain hydrogel which is programmable matter, and he wrote that the calamari clots are "biosynthetic blood clots": [https://acis-api.flcourts.gov/courts/68f021c4-6a44-4735-9a76-5360b2e8af13/cms/case/0f286d7b-ed19-4e35-b5ed-a58d26d2cfdd/docketentrydocuments/42db21c6-6c96-44fe-885c-bd5ddbcb1cfc]

In 2024 National ARM posted a video discussion of their board members, who included David Meiswinkle, Ana Maria Mihalcea, Joe Sansone, and Michael Diamond. [https://rumble.com/v53z69n-national-arm-board-member-discussion.html] At time 26:33 Meiswinkle told Mihalcea: "You have the videos and the dark field, you can show that, you have the nanobots in there, and you know the contents of it. And if more doctors that are good doctors, like McCullough or Kory would get onboard and look at your work - I think it's priceless - and that may be, you know, the thunderbolt or lightningbolt to wake up the masses." At time 46:00 Meiswinkle said: "Now, as far as other things that we're doing, the geoengineering is a big thing. Dr. Ana - and I've mentioned Clifford Carnicom - who had done papers together - and they found similarities, and I mean, those similarities, the exact same thing in the work that Clifford's been doing on the spraying. [...] They have filaments in there, and Morgellons filaments that could really disable you. And they've been doing that for quite a while. It seems that they've upped the ante by putting a lot of this stuff in concentrated form in the vaccine, so that the people like Dr. Ana is finding these giant hydrogels - or hydrogel filaments."

Meiswinkle and Diamond are both lawyers from New Jersey, but I don't think Meiswinkle is a Jew, because he doesn't look like a Jew, his father had a Christian funeral ceremony, his mother was a member of a church choir, and his sister is named Christa. [https://www.schlitzerallenpugh.com/obituary/Robert-Meiswinkle, https://www.schlitzerallenpugh.com/obituary/Felice-Meiswinkle, https://www.facebook.com/david.meiswinkle/friends] The name "Meiswinkle" is a rare alternate spelling of "Meiswinkel", but on Forebears.io both forms of the name have an estimated incidence of zero in Israel. [https://forebears.io/surnames/meiswinkle]

Another board member of National ARM is the Quantum Nurse Grace Asagra, who is from New Jersey like Meiswinkle. [https://nationalarm.org/board/] One of the advisors to National ARM is J. Michael Springmann, who is a former US State Department official who served as a diplomat in the US Foreign Service, and who is now a lawyer who practices in the DC area.

Other people who have suggested that the calamari clots might be a psyop

I have said for a long time that the calamari clots look like a psyop, but I have found almost no other people who have said the same thing, which is one of the reasons why I decided to write this series of articles, I'm covering novel territory that has not been researched by other people before me.

The standard line of fact checkers is that morticians mistake regular post-mortem clots for calamari clots, even though it wouldn't make sense why several morticians around the world would've started to synchronously mistake regular post-mortem clots for a novel type of rubbery clots in 2021, and to insist that the new clots are completely different from regular post-mortem clots. But the fact checkers don't consider the possibility that the morticians would be part of a coordinated disinformation campaign and they would systematically lie about seeing a new type of clots, which I think causes the fact checkers to present a false hypothesis about the nature of the clots.

In general mainstream people tend to view conspiracy theorists as either opportunists who are motivated by profit or fame, or as gullible fools, but mainstream people don't consider the possibility that a conspiracy narrative would be born out of a coordinated disinformation program.

Many people in the conspiracy movement have realized that the stories about graphene oxide, hydras, and nanobots are disinformation, even though for some reason few people have subjected the calamari clots to the same kind of scrutiny.

When I used several sets of keywords to search for users on Twitter who had said the clots were fake, I found a user called 767Aviatrix, who had posted these tweets: [https://x.com/search?q=from%3A767Aviatrix+calamari&f=live]

I also found a user called MPraesenti94131, who told John O'Looney that the clots were a psyop: [https://x.com/search?q=from%3AMPraesenti94131+%28clot+OR+clots%29&f=live]

Jikkyleaks is one of the few Twitter users I have seen saying that the clots might be a hoax. However he might have picked it up from me, because the first time I found him saying it was in a reply to my tweet, which was part of a thread where I posted evidence that the clots were fake: [https://x.com/Jikkyleaks/status/1764490073733816379]

Jikkyleaks later also posted these tweets: [https://x.com/Jikkyleaks/status/1833108622248698224, https://x.com/Jikkyleaks/status/1910243546810179729]

When I compiled evidence that the clots are a hoax on Kevin McCairn's Discord server, I got maybe one or two users to agree with me until I got banned from the server. I'm writing this over 4 months after I published the first article about the clots on my website, but so far I don't think there's anyone who has read my articles, so I don't think my website has convinced anyone that the clots are fake either.

I will expand this section later if I find more people who have said that the clots are a hoax or a psyop.

McKernan's hypothetis that the clots are caused by a cryptic ORF within the SV40 promoter

Kevin McKernan found a 23 amino acid cryptic ORF within the SV40 promoter sequence that is included in the Pfizer vaccine plasmid: [https://anandamide.substack.com/p/could-a-hidden-amyloidogenic-peptide]

Therefore his AI speculated that the ORF might result in the formation of the white fibrous clots, which is reminiscent of Greg Harrison's AI hallucinations about how the clots are caused by cryptic ORFs:

AmyloGram allows entering up to 50 sequences at a time, so I generated 50 random 23 aa segments of the protein coding sequences in SARS-CoV-2:

$ curl -s 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&rettype=fasta_cds_aa&id=MN908947'>sars2.aa
$ seqkit sliding -W23 -s1 sars2.aa|seqkit fx2tab|shuf -n50|seqkit tab2fx
>lcl|MN908947.3_prot_QHD43415.1_1_sliding:5605-5627
QGPPGTGKSHFAIGLALYYPSAR
>lcl|MN908947.3_prot_QHD43415.1_1_sliding:1405-1427
KYKGIKIQEGVVDYGARFYFYTS
[...]

McKernan's cryptic ORF had an amyloid likelihood score of about 0.6667, but 14 of my 50 random segments got the same or higher amyloid likelihood score: [http://biongram.biotech.uni.wroc.pl/AmyloGram/]

I also tried generating 50 random sequences of 23 amino acids:

for i in {1..50};do printf %s\\n \>$i $(tr -dc ACDEFGHIKLMNPQRSTVWY</dev/random|head -c23);done

But 9 out of 50 sequences got an amyloid likelihood score of 0.6667 or higher.

In 2023 when McKernan searched UniProt BLAST for the long reverse ORF in the Pfizer vaccine, the top match was a protein that was labeled as a spider silk protein, even though it was actually a misannotated protein from a bacterial sequencing dataset, and it was later removed from UniProt. Jessica Rose wrote a long post about the reverse ORF, where she made it seem like spider silk would actually be relevant to understanding the ORF, but she didn't say the BLAST match was due to chance, or that there were many other random proteins with a similarly close match on BLAST. She also came up with a theory that the calamari clots might be made of hydrogel formed by spider silk-like peptides, in the same way that Bryan Ardis said that the clots are made of two snake venom peptides in hydrogel.

However now Jessica Rose again said that McKernan's post about the cryptic ORF was a "great update", and she didn't have anything negative to say about the post:

The clots are like a mirror where people can see their pet topic, so Christie Laura Grace says the clots are caused by LNPs, Geoffrey Norman Pain says the clots are caused by endotoxin, Bryan Ardis says the clots are caused by snake venom, and Kevin McKernan says the clots are caused by SV40 promoters.

McKernan previously also speculated that fibrin clots might be caused by plasmid DNA: [https://x.com/Kevin_McKernan/status/1921652483706736654]

Hirschman may have mentioned the clots on Facebook before the Jane Ruby Show

A Substack author who published a text-only interview of Hirschman wrote: [https://billricejr.substack.com/p/my-visit-with-historys-most-important]

The first time he shared what he was seeing with the public was a reply he made to someone else's post on Facebook.

"If you could see what I see in the embalming room, you'd be concerned," he wrote.

A man in Cyprus, Greece (Andrew Clarke) picked up on Richard's comment and the two men began sharing personal messages. In one of these messages, Richard shared photos of the strange clots.

Clarke immediately sensed this visual evidence - if shared widely - might shake up the world.

Richard agreed and, indeed, several of his closest colleagues in the funeral business were now saying, "Someone needs to show this to the world." But nobody did ... yet.

However the post didn't include a link to the Facebook comment, and Facebook doesn't support searching for comments based on their text content. I asked the author of the post to link to the comment, but he didn't reply.

The quoted part of the Facebook comment didn't even explicitly refer to a new type of clots, so I don't know if the comment should be counted as the first public reference to calamari clots. Even if the comment is real, Hirschman may have originally referred to something else by his comment, but he might have later lied and said he meant the clots.

As of now I have not even found a single tweet or Facebook post that would have referred to the clots before 2022.