Part 1 is here: clot.html.
During an interview with Mary Holland from CHD, Ana Maria Mihalcea claimed that the calamari clots contained spider silk protein. She said: "Clifford Carnicom and I have got the deceased clots from Richard Hirschman, we got a clot from a living vaccine injured person, and from an unvaccinated individual. And what we looked at is clearly this rubber-like material that we know about. And we did by mircoscopy, and we found the same filaments that we see in the blood, absolutely the same stuff, okay. And then we did near-infrared spectroscopy and found that these things have a polyenes, which is polyethylene alcohol, polyvinyl alcohol, which is plastic, and polyamide, which is silk, nylon, or Kevlar. And specifically, you know, Kevin Kerningham, Dr. Kerningham [meant McKernan] found the genes of DNA of spidroins of spider silk. That's the strongest military-grade material that they have made. And so we found these in the clots." [https://x.com/ChildrensHD/status/1845970364993798325, time 41:40]
However McKernan did not actually find a spidroin protein in the Pfizer vaccine sequence, but "spidroin" was a nickname he gave for the long open reading frame he found on the reverse strand of the Pfizer sequence. When he searched for the reverse ORF on UniProt BLAST using extremely liberal settings, the closest match happened to be a protein that was annotated as a spidroin by chance, even though it was an extremely distant match that had only about 25% identity, and it wasn't returned as a hit when he ran regular BLAST with the default settings: [https://anandamide.substack.com/p/spider-webs-in-the-pfizer-closet]
The spidroin protein sequence was likely misannotated, and it was removed from UniProt in June 2024, so it is no longer even returned as a result if you do a BLAST match for the reverse ORF. But before it had been removed, I downloaded the Pfizer plasmid sequence that McKernan uploaded to GenBank, and I picked the longest ORF on the reverse strand:
$ curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=OR134577'>pfizerplasmid.fa
$ r=$(seqkit seq -rp pfizerplasmid.fa|seqkit seq -s);for x in $r ${r:1} ${r:2};do sed 's/.../& /g'<<<$x|grep -Po 'ATG.*?(?=(TAA|TAG|TGA))'|tr -d \ ;done|awk '{print">"NR}1'|seqkit translate|seqkit sort -lr|seqkit head -n1|seqkit seq -s
MQYQLESSCVVQFHALQHGLRIVLVELAAAATATTALQAATAAGHATQHDCDHHDGNQSGDKAQPDVPGPLDVLLVLPQFLQVDQALVQILGHLVQPVDLFLDVHDAGIDSADIAQVHVGACVVLKVLVQFLFEAVQLGLQRVVHGIVHNADHDVAVARHEGVVGGDDLGLVEVPLCHEPMGAVGHEHAFSRKVGFAVVADGWSGGEILLLSGHICHVQKHHAVRGRLREAHQVVALAAKVHSLALAQHTLRHLGGGQIGRGSNLGGSDQLLGHVCLEALQSACDQSVDLHLGLRRVQSAQDIVQHRADGAELGGQLLDQGVQCLGIVVDHVLQLSQGACCAAQAVLDLADGAVELVGDQLLVLVQHILGHSDAVEPVGHLHSKGDLQSGACSKCPAACDCAGQQGRCVLGDHLIGQQRRQHCQSVKLLGANQIPGGNVAQTIAILLDEAGVGQCHFVEQQVLDEAPLAGLARIGQNLAEIEAAEVLDRRGLVDLLHLGEHLLGVLVLFHGDPCQGSFQLGAEAAVLQQQVGALGGIAADVHGAVHAGLGHGHRQDLCGHADGEVGGDSDRVVGVGHAVLGAQRHCVGNDALAGHASGSPVALCLCLVAGADSSADGDVALVAIVHVLGSDQTAGSGLKHIAAGGVHPPCRCQLIGVNGHGHFGTVHALVQHCHLIAGVGARGDHRHSAEAARGDVQDFQCLGISNGVCGIGDIPAKLLEWQELLVALCQHAGAGQAVEVEVHAFVLHEIGAFLRAAHCGRGMQQFEAQHHHSVGLVAHAVCGPKAVGLQWEVAVHACHAVTRLVAGLIDLGGDVPLEGLQIGLPEQPVPVIVVAADFGVQLVAVPGNHTAGEVVGQLVVVVGDVACLSRGNLPHFVSPDHEAVGVHVCEAQVVQLGRGHAVALECEEGGEVVQHGVVGHAIADPLPVPGVHRGESGGIEHLVEGAQIGDIGEPHDGFGGLHPEVAGLVDALFHGEGLQGALCLAQRIQSTIHGVGDGAVLVVLQQEGSRLQVAHIVSGGTSCPSAAAIARCQVASVQGQQCLKPGDVDADGQIHQGFQSREALRQIPAEVDRGVLAVDLEVAVDVLKHELAQVLEVALLAFQVHQERLGHVLEGAVVGAAVHPELAFHPALVVLVVVDVQEGVVAELELAHFDDHVGGVVHDQQALGLAVQCGAEDPASDDVGLLGAGKVHPVVEGQHGVVESLGAIGAGDGVEPGHVAEERQEQVLGRVQHAGSEHLVGVVHASGKAVGV
Then I pasted the ORF here and clicked "Run BLAST": https://www.uniprot.org/blast. McKernan ran his BLAST search in late 2023, but I ran the search several months later when there had been more sequences added to the UniProt database. So now the spidroin protein only came on third place, but the best two matches were a protein from algae and a cockroach protein. But all of them had a poor match with only about 25% identity:
From the table above you can also see that the match to the misannotated spidroin protein has a length of 1,496 aa and about 24% identity, but the matches to the next 5 closest proteins have similar percentage identities around 25% and length around 500-4000 aa. The match to the spidroin has an E-value of about 1.3e-9, which is meant to indicate how many similarly close matches are expected to occur by chance. But in this case the E-value is clearly too low, which might be because the query sequence had an unusual distribution of amino acids because it was the reverse complement of a codon-optimized sequence, but the E-value was calculated using the BLOSUM62 substitution matrix which assumed a natural distribution of amino acids.
ChatGPT said:
3. Query Composition Bias
- You mentioned the ORF comes from a reversed codon-optimized sequence.
- Codon optimization can create atypical amino acid distributions after translation, leading to stretches of sequence resembling glycine-rich or repetitive motifs.
- This can mimic spidroin-like sequences (which are glycine-rich) even though there is no functional homology.
- BLAST's substitution matrices (e.g., BLOSUM62) assume natural protein composition. With an unusual sequence, scoring becomes misleading.
4. Scoring Matrix and Gap Penalties
- Default BLAST parameters are designed for natural protein sequences.
- If the query sequence has biases (e.g., glycine-zippers, repetitive motifs), the scoring matrix may give artificially high scores for spurious alignments.
- This affects both the bit score and the derived E-value.
5. Statistical Assumptions Violation
- BLAST's E-value assumes random sequence alignments under certain statistical models.
- For sequences derived from reverse strands or synthetic constructs, these assumptions no longer hold.
- Hence, the computed E-value is numerically correct but biologically meaningless.
Both the misannotated spidroin protein and the reverse ORF do in fact have a high percentage of glycine:
# download MaSp1 sequence from UniProt, McKernan's Pfizer plasmid sequence, and coding sequences of SARS-CoV-2
curl 'https://rest.uniprot.org/unisave/G1Y380?format=fasta&versions=18'>spidroin.fa
curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=OR134577'>pfizerplasmid.fa
curl -s 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&rettype=fasta_cds_aa&id=MN908947.3'>sars2.aa
# find longest ORF on reverse strand
r=$(seqkit seq -rp pfizerplasmid.fa|seqkit seq -s);for x in $r ${r:1} ${r:2};do sed 's/.../& /g'<<<$x|grep -Po 'ATG.*?(?=(TAA|TAG|TGA))'|tr -d \ ;done|awk '{print">"NR}1'|seqkit translate|seqkit sort -lr|seqkit head -n1 >reverseorf.fa
# make file where first column shows sequence name and second column shows amino acids
(seqkit seq -s sars2.aa|paste -sd \\0 -|sed 's/^/sars2 /';for x in spidroin reverseorf;do echo "$x `seqkit seq -s $x.fa`";done)>spidsilk
# make table of amino acid percentage in each sequence
awk '{split($2,z,"");for(i in z){a[z[i]][$1]++;sum[$1]++}}END{o="aa";for(j in sum)o=o" "j;print o;for(i in a){o=i;for(j in sum)o=o sprintf(" %.1f",a[i][j]/sum[j]*100);print o}}' spidsilk|sort -nk4|column -t
The output shows the percentage of each amino acid sorted by the column for the reverse ORF:
aa spidroin sars2 reverseorf Y 0.1 4.6 0.1 M 0.3 2.1 0.2 W 0.0 1.1 0.2 N 0.5 5.5 0.9 T 2.5 7.4 1.0 K 0.3 5.8 1.2 F 0.2 5.1 1.8 P 1.3 4.1 3.0 C 0.3 3.0 3.1 I 2.7 5.2 3.2 R 6.4 3.6 3.2 S 0.6 6.8 3.5 E 2.3 4.5 5.2 D 10.2 5.2 5.9 H 5.3 1.9 7.6 Q 10.1 3.8 8.0 L 2.7 9.5 11.7 A 22.4 6.8 12.3 G 18.0 5.9 13.6 V 13.9 8.0 14.2
ChatGPT said:
Spider silk proteins (spidroins) and the reverse open reading frame (ORF) of the Pfizer plasmid exhibit similar amino acid compositions, but for entirely different reasons. In the case of spider silk, the biased amino acid composition is a result of evolutionary selection for mechanical properties such as strength, elasticity, and hydrophobicity. Spidroins are rich in glycine and alanine, which contribute to flexible and crystalline regions of the silk, respectively. Leucine and valine are also prominent, helping to stabilize hydrophobic interactions. Conversely, spidroins contain very low amounts of aromatic residues (tryptophan, tyrosine, phenylalanine) and polar charged residues, as these are not advantageous for the physical properties of silk fibers.
In contrast, the reverse ORF from the Pfizer plasmid is not a biologically meaningful protein. Its amino acid composition is an artifact that arises from codon optimization used to express the vaccine gene efficiently in human cells. Codon optimization increases the frequency of certain nucleotides, particularly guanine and cytosine, to match human codon usage preferences. When this optimized sequence is taken in reverse and read in an alternative frame, it produces a pseudo-protein sequence with an amino acid composition that reflects these underlying nucleotide biases rather than any functional protein-coding information.
As a result, the reverse ORF also shows a high abundance of glycine, alanine, leucine, and valine. This is because codons rich in guanine and cytosine frequently map to these amino acids when read in the reverse complement strand. Other residues like glutamine, aspartic acid, and histidine also appear with elevated frequencies due to similar codon artifacts. The similarity in amino acid composition between the spidroin and the reverse ORF is therefore coincidental, stemming from the statistical properties of the genetic code and the influence of codon optimization, rather than from any evolutionary relationship.
This convergence in amino acid composition leads to misleading BLAST results. BLAST scoring is affected not only by exact sequence identity but also by overall composition similarities. Consequently, even sequences with low identity can produce low E-values if their amino acid distributions are comparable. In this case, the reverse ORF's accidental resemblance to spidroin composition results in false-positive BLAST hits, despite the lack of true homology. This reflects a composition-driven artifact, not an indication of biological relatedness.
The spidroin protein is no longer returned as a match by UniProt. The protein was deleted from UniProt in June 2024 for the reason that that it was an "excluded proteome": [https://www.uniprot.org/uniprotkb/G1Y380/history]
UniProt says that reasons for excluding a proteome include incorrect assembly, contamination, or misidentification of the source organism. [https://www.uniprot.org/help/proteome_exclusion_reasons]
The source organism of the protein at both UniProt and GenBank listed is a bacterium called Nitrospirillum amazonense. But bacteria do not produce spider silk unless they have been modified genetically, and the protein sequence came from a paper which described a natural species of bacteria and not genetically modified bacteria.
The entry for the protein at UniProt was copied from this entry at GenBank: https://www.ncbi.nlm.nih.gov/protein/EGY00023. The entry at GenBank includes some metadata that was missing from UniProt, including a note for the CDS that says "identified by sequence similarity; putative".
ChatGPT said:
The entry shown for Nitrospirillum viridazoti Y2 listing "Major ampullate spidroin 1 MaSp1" is likely a case of misannotation due to automated sequence similarity searches. Here is why this happens:
1. Annotation by Homology: The GenBank entry notes that this sequence was "identified by sequence similarity; putative." This means that during the annotation pipeline, the protein sequence showed local similarity to known spidroin sequences, possibly because of repetitive glycine- and alanine-rich regions or structural motifs that resemble spidroin proteins. Such repetitive domains are common in unrelated proteins across various species.
2. Spurious Similarity to ATPase Domains: The region annotation (COG3903) refers to a predicted ATPase domain, which is a general function category not specific to silk proteins. ATPase domains are found in many proteins across life forms. The resemblance to spidroins might arise from structural repeats or motifs that coincidentally align with spider silk sequences, especially in large, repetitive bacterial proteins.
3. Conceptual Translation Artifact: The comment mentions "Method: conceptual translation," indicating this is a predicted open reading frame (ORF) from genome sequencing data, not experimentally validated. Large bacterial genomes often contain long ORFs with repetitive low-complexity regions that can artifactually match spidroin sequences in databases.
4. Misleading Product Naming: The product is named "Major ampullate spidroin 1 MaSp1," but this is a bioinformatic label assigned due to sequence similarity, not functional evidence. No experimental data supports that Nitrospirillum viridazoti produces spider silk proteins.
5. Source Confusion: Nitrospirillum viridazoti is a nitrogen-fixing bacterium associated with plants, not arachnids. There is no biological reason for it to produce silk proteins. The naming likely results from a bioinformatics pipeline matching a segment of bacterial protein to a spidroin database entry.
This lady on Twitter said that the spidroin clots can be activated remotely (which is similar to the theory by Mike Adams that the calamari clots contain electric circuits that can be triggered by 5G to kill people): [https://x.com/LouiseBrookes8/status/1904546516292821189]
Someone on Twitter said that the reason why the clots are stained by Thioflavin T might be because spidroin has amyloid-like properties: [https://x.com/mvwinds/status/1863467028960706983]
Ulrike Kämmerer said that the reverse ORF actually codes for spider silk, but she didn't mention anything about how the ORF only had an extremely distant match to a spidroin sequence at UniProt, or how the sequence was misannotated. And she said the spidroin is extremely durable, and that once the human body has been instructed to form spidroin, the spidroin can no longer be degraded because it is a foreign protein, which will lead to the buildup of spider silk inside the body. She said it was similar to the accumulation of prions in mad cow disease, and she said the spider silk will destroy cells as it accumulates in human tissue. And she said that Arne Burkhardt had found symptoms of a new type of amyloidosis in people who died from a COVID vaccine, which she speculated might have been due to the spidroin protein. [https://www.aussie17.com/p/biologist-prof-dr-ulrike-kammerer]
Added later: Kevin McKernan told me that a utility called AmyloGram predicted that the reverse ORF was amyloidogenic: [https://x.com/Kevin_McKernan/status/1928488367114580033]
Amylogram predicts that ORF to be amylodogenic.
Who cares what's it's called why are you playing guilt by association games?
Classic chaos agent subterfuge.People are free to speculate on other peoples data and the person who generated that data isn't responsible for their thoughts.
http://biongram.biotech.uni.wroc.pl/AmyloGram/
Once again.
Lazy Henjin didn't run that novel ORF through any analysis but instead spergs out what its name might be?
Novel ORFs usually mean they don't have good nomenclature you 1W incandescent bulb.
I told him that maybe AmyloGram was designed to be used with sequences shorter than 1252 aa, because the sequences that were included as sample input were all between 11 and 23 aa long:
The paper about AmyloGram said that the maximum length was 15 aa in the set of sequences that was used to train AmyloGram, and in the paper AmyloGram was tested on a set of sequences with a length between 6 and 25 aa. [https://www.nature.com/articles/s41598-017-13210-9]
I tried generating 10 random 20 aa sequences:
$ for i in {1..10};do printf %s\\n \>$i $(tr -dc ACDEFGHIKLMNPQRSTVWY</dev/random|head -c20);done
>1
MYPYHEMSWGYDCVMVVRFW
>2
WDWWDASEWRHQSHWMIPML
>3
SRGIKGDQSEHANTCLAYSN
>4
CHPPVANPWPIEENSVPRCR
>5
TWTTNGQSIAEGAQRMPDNI
>6
LLLSCPDSLVWMFLPFTMVM
>7
NTAQGWAEPRTIFFKAPFTD
>8
TRADPTGVLEDFNLFSILNY
>9
FYVTIAKQSIAKYLNDIGGK
>10
YDPDTWIQWTCPSMKHPYNE
I also generated 10 random 1252 aa sequences. The average amyloid probability was about 0.89 for the 1252 aa sequences but only about 0.52 for the 20 aa sequences:
McKernan got an amyloid probability of about 0.85 for the reverse ORF, so it was actually below the average amyloid probability of my 10 random 1252 aa sequences.
Ana Maria Mihalcea has a unique theory on how the calamari clots are formed, because she told Mary Holland from CHD that the clots are formed when nanobots eat red blood cells: "I analyzed these clots microscopically and found these nanotechnological filaments in there. And Clifford Carnicom and I - we also did chemical analysis on them. I also filmed how the clots actually assemble. What you see is unvaccinated blood, the nano robotic swarm. You see all these green and orange and yellow lights. And they are hijacking the electricity from the red blood cells, and they're killing them basically to feed themselves. It's called energy harvesting, it's well described in the nanotechnological literature. And so these robots then, what they leave in their wake is this. This is the same blood 30 minutes later. The blood is completely destroyed. The robots have moved on. And this is the rubbery clot that we've been seeing. And that you can see how it self-assembles, and literally builds when you are leaving the - when you're drawing the blood, and you are leaving it out for at least four hours." [https://rumble.com/v5gadat-what-is-in-our-blood.html?start=2510] The image below shows her "nanorobotic swarm" of green and orange and yellow lights (and it's also depressing to note that her interview with CHD has 101 upvotes and 1 downvote on Rumble):
During the interview with Mary Holland from CHD, Mihalcea also said:
But somehow Mary Holland didn't have anything critical to say to Mihalcea, and she never asked Mihalcea questions like "How do you know that?" or "What's your source?" or "How can you see nanotechnology with a light microscope?" or "Isn't that just Brownian motion and not quantum dots?"
Ana Maria Mihalcea wrote that Hirschman's clots contained Morgellons bacteria and Morgellons filaments: [http://web.archive.org/web/20230711070359/https://anamihalceamdphd.substack.com/p/blood-clot-analysis-from-living-and]
Our findings:
- The filament structure is a 1:1 match to our previous findings as well as consistent with 30 years of research done by Clifford Carnicom.
- Cross Domain Bacteria, the origin of filament genesis are visible within the clots
- This appears to produce an amorphous protein structure
- Stray blood cells are present
It appears that the rubbery clots are a more advanced and extreme evolution of the CDB/ Morgellons filaments.
CDB or cross-domain bacteria is Clifford Carnicom's name for the supposed causative agent of Morgellons disease. Ana Maria Mihalcea also claims that chemtrails contain both Morgellons filaments and spider silk: [https://www.google.com/search?q=site:anamihalceamdphd.substack.com+chemtrail+spider+silk]
In September 2023 Richard Hirschman wrote this about his clots: "I know that there have been some people looking into them. publicly the only people who have spoken about what they have found or seen are, Dr. Ryan Cole, Dr. Ana Mihalcea and Mike Adams. There have been others but I am not aware of any of their findings." [https://x.com/r_hirschman/status/1700596168256880863] But if Hirschman was for real, would he have wanted Ana Maria Mihalcea to say that his clots contained Morgellons filaments, Morgellons bacteria, and spider silk? Or would he have wanted Mike Adams to say that his clots contain electric circuits and nanowire interface structures? I haven't found him denouncing the claims by Mike Adams or Ana Maria Mihalcea anywhere. [https://x.com/search?q=from%3Ar_hirschman+%28mike+adams+OR+mihalcea%29&f=live]
Ana Maria Mihalcea is a member of a neo-Theosophical cult called Ramtha's School of Enlightenment. Their leader JZ Knight claims to be channeling a 35,000-year-old Lemurian ascended master called Ramtha. Mihalcea wrote a document about the medical miracles that were manifested in the body of JZ Knight, which included that JZ Knight's DNA changed to male DNA while she channeled the ascended master: [https://docs.wixstatic.com/ugd/72ba1c_2971020dc9154de89ba121994d187882.pdf]
An account that promotes Miles Guo posted this video where Ana Maria Mihalcea said that she had found spider silk in calamari clots. The video included this slide about the reverse ORF from a presentation by David Speicher, which featured a photo of calamari clots as if the clots were somehow related to the reverse ORF: [https://x.com/aus_mini/status/1813411573085692059]
In an interview David Speicher did in September 2024, he said: "If you encode going reverse, you get another intact open reading frame that's perfectly intact. You get this whole fibroin heavy chain, which is major ampullate spidroin 1, MaSp1. And that is the same fibroin that's found in silkworm silk. And what are we pulling out of the dead vaxxed people? All of these white fibrinous clots. And these silk proteins are used in spider silk. The thing about spider silk is that if it's in the spider at the right pH and the temperature, it's a liquid form. If it's outside and it cools and the pH changes is when things start to solidify and make silk. So I think - and a lot of groups worldwide are looking at this - but there could be a major link between these clots and what's actually in the intact plasmid DNA." [https://www.drtrozzi.news/p/genetic-invasion-an-update-with-dr, time 27:28]
Speicher showed the slide below where the percentage identities of the matches were covered up, so people couldn't see that the matches had only about 25% identity. His amino acid alignment still showed that most positions of the alignment did not match, but many members of his audience probably did not understand what the alignment meant. And Speicher didn't say anything about how the match to the spidroin protein had an extremely low identity and how it was likely due to chance:
When Speicher said that "you get this whole fibroin heavy chain, which is major ampullate spidroin 1, MaSp1", he mixed up the spider silk protein that was the first match with the silkworm silk protein that was the third match. But they were two different proteins, and the fibroin was not a spidroin or vice versa. However both proteins had the host species listed as a species of bacteria which doesn't produce either spider silk or silkworm silk, so both sequences were likely mislabeled, and they have both now been deleted from UniProt.
Speicher also showed this slide which suggested that the calamari clots might be connected to the reverse ORF:
Speicher has a PhD degree in virology, and he has a postdoctoral fellowship in bioinformatics, so I have a hard time believing he would be stupid enough to think that the reverse ORF would actually code for spider silk. It seems more likely that he is deliberately promoting disinformation. But he is also one of the main people who have pushed Kevin McKernan's narrative about DNA contamination, which I think increases the likelihood that it's a disinformation narrative (even though the DNA contamination itself seems to be real, but its implications seem to be vastly exaggerated by McKernan and Speicher). But it's interesting that McKernan is now also one of the people who is supposed to have analyzed the calamari clots in a lab.
In October 2023 a preprint about DNA contamination was published by David Speicher, Jessica Rose, Maria Gutschi, David Wiseman, and Kevin McKernan. [https://osf.io/mjc97_v1/] In 2023 Maria Gutschi did a presentation where she said: "So Kevin and group tried to determine what does this protein make - what does mRNA make. The closet thing they found was silk protein, spider protein. Spider silk. Wow. And so, we don't know if that's happening or not - there's a lot that needs to be done - and whether that is the case. But it is a large concern on my side. Because it is not an accident that this mRNA is there on the opposite side. In my opinion it's not." [https://crowdbunker.com/v/23fVajqu, time 26:25]
Jessica Rose has written many Substack posts where she has presented Kevin McKernan's findings in a popularized format. She also wrote a Substack post about the reverse ORF, where she spent most of the post writing about spider silk as if it would somehow be relevant to the reverse ORF, and as if people needed to learn about spider silk to understand the reverse ORF. [https://jessicar.substack.com/p/what-a-tangled-web-we-may-have-weaved] She also wrote about a paper titled "Spidroin N-terminal domain forms amyloid-like fibril based hydrogels and provides a protein immobilization platform", and she concluded the post by writing: "Could it be that amyloidogenic peptides akin to spidroin are being translated in people and subsequently creating immobilizing hydrogel scaffolds for other proteins?" (But Bryan Ardis also said that the calamari clots are made up of two snake venom peptides in hydrogel, and Ana Maria Mihalcea has said that the clots are made of both hydrogel and spider silk. This McKernan-Rose-Speicher-Kämmerer network is starting to look like a backup net that catches people who are too refined to be captured by the Peters-Ruby-Ardis-Mihalcea net.)
In her Substack post, Jessica Rose briefly mentioned that the reverse ORF had a weak homology of only about 25% to the spidroin protein, but she didn't write about how the match was likely due to chance, and how the spidroin had nothing to do with the reverse ORF, and there were many other random proteins that had a similarly close match. And she didn't even post instructions on how people can repeat the BLAST search themselves or how people should interpret the BLAST search. I called her out for how misleading the post was, because she must have known it would be misinterpreted by her readers. [https://x.com/henjin256/status/1848961827415249112] Jessica Rose has a PhD degree in the computational biology of viruses, so she should've known the reverse ORF had nothing to do with spider silk, so her post seemed like she was deliberately trying to mislead people.
In March 2025 Richard Fleming published a PDF by the Czech biologist Soňa Peková, who is supposed to have verified McKernan's finding of DNA contamination, and who is basically the Jessica Rose type figure of the Czech Republic. It might be a coincidence, but Soňa Peková is a member of a neo-Theosophical cult called ALLATRA that has many similarities to Ana Maria Mihalcea's cult: https://jessicar.substack.com/p/the-new-slovakian-report-showing/comment/100916301. ALLATRA teaches that reality is oppressed by Draco Reptilians, that Slavs are the oldest ethnic group after the fall of Atlantis, and that there is a 12,000-year pole shift cycle. In one of her interviews Soňa Peková talked about Pleiadians and 5D ascension, and she said that Gaia has the capability to reach not only 5D but 9D reality, even though vaccinated people may not be able to reach a higher dimension. Even though the cult is overtly based in Ukraine, they run a multilingual media operation that produces content in various languages, and their most popular content are English-language deep fake videos that employ the avatar of an American veteran spook called Egon Cholatkian. And in the same way that Scientology is partnered with the Nation of Islam, ALLATRA is also partnered with an African American freemasonic lodge called the World's Masonic United Nations.
A user on Twitter said that the clots in the thumbnail of this video were "calamari-like clotting", even though the clots had formed inside a surgery drain tube: [https://x.com/CheweyLife/status/1914528829890068632]
But an MD user replied: "Uhm, yeah. After week of surgery drainage, white clotting in them is not unusual at all. After all its the fibrin rich wound secretions drained through plastic tubes. Usually you pull them, before they clot. Its totally different to havin white clots build-up inside blood vessels". [https://x.com/53v3n0fn1n3/status/1914690994529849616] The user also wrote: "Clotting cascades are triggered on the wounds surface. Clotting in these tubes starts when the suction doesn't work properly. Some get them, some don't. Lymphadenectomy can leave a huge wound inside, so drain is left as long as secretion keeps going, weighed with inf. risk."
Later when another user posted a video of the clots in a surgery drain tube, the MD user pointed out that it was a surgery drain tube, and that wound secretions that are drained by the tube have a high fibrin content: [https://x.com/53v3n0fn1n3/status/1915703836171215355]
Richard Hirschman also shared the same video by the lady who showed the clots in a surgery drain tube, and he wrote: "The clots she shows look very similar to the ones that I have been seeing during the embalming process, the difference is she's alive and those who I embalm are not. If the clots are the same, they can't just be postmortem. There was a vascular surgeon whistleblower who spoke with Dr Philip McMillan about the same type of clots that he has been seeing. How does a vascular surgeon remove postmortem clots during the surgery on a living person?" [https://x.com/r_hirschman/status/1914458661021475307]
In March 2024 NZDSOS tweeted this photo of "rubbery white structures being discharged through a surgical wound drain site" (but it may have just shown regular clots in a surgical drain tube): [https://x.com/nzdsos/status/1767386236925387026]
The earliest place where I found the same photo posted was in the blog of NZDSOS, where the photo was not given any source but its caption said "Photo Provided for Use - Copyright Free". [https://nzdsos.com/2024/02/20/rubbery-clots-campbell/] So I guess it's an original photo published by NZDSOS.
Greg Harrison also posted the photo and two other photos which he said were clots that came from living subjects: [https://x.com/Greg21143362/status/1776172411819594066]
Some of the clots that are presented as calamari clots may have been created by a device like a Chandler loop device, where blood is repeatedly passed through a tube until clots form in the tube. Here's images of blood clots created with a Chandler loop device (where the scale bar is 2 cm, so the longest clot in image L20 is about 30 cm): [https://link.springer.com/article/10.1007/s10856-023-06721-7]
The image below demonstrates how the device works: "A photo of the assembled Chandler loop apparatus with blood running in the device. C Illustration depicting clot formation within the Chandler loop at the forward meniscus".
In another study a Chandler loop device was used to produce clots that had close to a pure white color, as can be seen from images A and B below: [https://link.springer.com/article/10.1007/s10856-024-06775-1]
In order to manufacture clots with the amyloid properties observed by Kevin McCairn, perhaps bacterial LPS could be added to the blood to induce misfolding of fibrin, like what was done by Pretorius and Kell who wrote: "Here, we show that the addition of tiny concentrations (0.2 ng l(-1)) of bacterial LPS to both whole blood and platelet-poor plasma of normal, healthy donors leads to marked changes in the nature of the fibrin fibres so formed, as observed by ultrastructural and fluorescence microscopy (the latter implying that the fibrin is actually in an amyloid β-sheet-rich form that on stoichiometric grounds must occur autocatalytically)." [https://pmc.ncbi.nlm.nih.gov/articles/PMC5046953/]
Laura Jeffrey said that the new type of white clots often had red clots attached to their end, so that the white clots appeared to be feeding on the red clots. A similar story was told by Hirschman, the anonymous embalmer whose photos were shown by Jane Ruby, and the Canadian funeral director Carolyn who was interviewed by Epoch Times.
But normally red clots form in veins and white clots form in arteries, so it would be unusual to see both type of clots in the same blood vessel type. ChatGPT said:
- Venous thrombi (often called "red thrombi") form under low-flow conditions and are composed mainly of fibrin and red blood cells, giving them a darker appearance. However, they also contain platelets.
- Arterial thrombi (often called "white thrombi") typically form under high shear stress conditions and are composed predominantly of platelets and fibrin. These clots are more compact and pale due to the relative scarcity of red blood cells.
"Currant jelly clots" are postmortem clots, but they also form in veins and not arteries. Normally both in the case of post-mortem clots and clots that are seen in living people, the red clots are more common in veins but white clots are more common in arteries. ChatGPT said:
Currant jelly clots are a type of postmortem clot that typically form in veins and the right side of the heart due to the low-pressure, slow-flow conditions present in these areas after death. They appear dark red, soft, gelatinous, and homogeneous, resembling currant jelly, which results from the settling of red blood cells and fibrin in the absence of circulation. These clots are not adherent to the vessel wall and can be easily removed, distinguishing them from antemortem thrombi.
In contrast, arteries operate under high pressure and fast flow, both in life and during the early postmortem period. These conditions make the formation of currant jelly clots in arteries unlikely. Instead, after death, arteries may remain empty, or they may contain pale "chicken fat" clots, formed from the separation of plasma and red cells. The rapid flow in arteries prior to death and the lack of blood stasis afterward do not support the layering and sedimentation needed to produce the appearance of a currant jelly clot.
Because of these differences in hemodynamic conditions and postmortem physiology, currant jelly clots are not found in arteries. Their formation is a product of the low-flow, static environment of the venous system and is considered a normal postmortem finding rather than a pathological process.
Regular white arterial clots don't normally reach a length longer than a few cm. So if long calamari clots would form in the arteries of living people, it would make them distinct from regular white arterial clots. ChatGPT said:
White arterial thrombi, also known as white clots, are typically relatively short in length compared to venous thrombi. They commonly measure from a few millimeters to a few centimeters. In rare cases, particularly in larger arteries such as the aorta or carotid, they may extend to several centimeters. However, such instances are uncommon.
These thrombi form under conditions of high shear stress, where rapid blood flow and endothelial injury - often due to atherosclerotic plaque rupture - promote platelet activation and fibrin deposition. The resulting thrombi are firm, pale, and platelet- and fibrin-rich. They are usually attached to the vessel wall at the site of injury and do not extend far longitudinally, as the high-pressure arterial environment tends to fragment or dislodge longer thrombus formations.
In contrast, venous thrombi can grow to lengths of 20-30 cm or more, often forming extensive casts of the affected vein. This is due to the lower flow conditions in the venous system, which allow more gradual accumulation of fibrin and red blood cells.
For example, in myocardial infarction, the thrombus that occludes a coronary artery is typically only a few millimeters long, yet sufficient to block blood flow. In summary, white arterial thrombi are usually short, often less than 5 cm, with longer formations being rare and limited to larger arteries.
Philip McMillan offers a free online course about the calamari clots, which is basically just a website where you have to enter an email address in order to see the content. The course features a section titled "Observations from Endovascular Surgeon", which consists of a 5-page document that looks like a letter from a surgeon to McMillan: [https://vejonhealth.learnworlds.com/course/embalmers-clots-composition-and-cause, f/mcmillan_letter_from_endovascular_surgeon.txt]
The surgeon wrote that they had not seen calamari clots in their lab: "Anyway, I was looking for examples of what I heard your guy talking about. We also did a lot of vein patients but, once again, though I was watching out for these cases, I never saw/heard about any of our patients (and we had a very active Vein Practice, at least prior to Covid) having extensive venous blockages like your witness produced. DVT's are not that uncommon in a very busy vein ablation practice. We were doing upwards of 30-45 venous ablations a week, on average, prior to Covid. Covid really did a number on us, like other clinics, especially when people started locking down. But the DVT's that we experienced post mRNA Vaccine deployment, and once again, the vast majority of our patients were mRNA vaccinated, their clots were easily managed and fully resolved with a course of anticoagulative treatment, usually within 2-3 weeks. There had to be one in there, but maybe we just didn't identify it."
The surgeon also wrote: "Without understanding the timing of onset of theses white, fibrous clots, when they began forming, either weeks/months prior to their event or just days before their event, I don't know how we could have missed these blockages during the procedures. Moreover, all of our patients, within a week or two prior to a venous ablation or arterial intervention, had a full vascular ultrasound study that would certainly have demonstrated these obvious tissue amalgamations, even the smaller ones. Most certainly the larger ones I've witnessed on your podcasts with your whistleblowers and your embalmers. No way, with our technologist talents, could these growths have been missed."
The surgeon speculated that the reason they weren't seeing the clots may have been if the clots formed soon before death: "The only real conclusions I can come to, during the entire time of witnessing our practice's patient demographics and the procedures we performed on them, and many of them were repeat customers, sometimes requiring multiple repeat annual interventions, is that these blood clots, fibrous or jelly, must happen rather abruptly, because our patients typically receive follow up vascular Ultrasonography 2-3 times per year, and we never noticed these large blockages that would certainly, without a doubt be able to visualized. Our equipment was the best. Our very best techs would have found them too. My surgeon partner looked at every single study personally. Nothing out of the ordinary, anyway. So this makes me hypothesize that these structures must form very quickly in an acute way, resulting in the patient needing an emergency trip to the hospital, or dying and going to the embalmers." However for example Tom Haviland has said that the reason why morticians say they only started seeing the clots in mid-2021 might be if the clots take about half a year to form. And Nicky Rupright King said she didn't start seeing the clots until 2022, and she suggested the clots might take more than a year to reach their full size. And anyway if the clots only take days to form, then why weren't embalmers already seeing the clots in January 2021?
The surgeon who sent the letter to McMillan wrote: "Unlike the clinic of the Whistleblower in your podcast, that was a hospital that did every body part, from the brain to the heart to the lower extremities, we were limited to doing pelvic and lower extremity endovascular atherectomies and angioplasties. Of course we did some stenting, when necessary." But I don't think that would explain why people in his lab were not seeing any calamari clots. A more likely explanation is that the clots are a hoax, and McMillan's cath lab whistleblower was lying.
I didn't find the surgeon's letter published anywhere else. I also haven't heard McMillan mention the letter anywhere, and I didn't find it published on his blog, which might be because the letter conflicts with the narrative about the clots he is trying to present to his audience.
In May 2023 Stew Peters released a sequel to the Watch the Water film, where Bryan Ardis said that COVID was caused by snake venom in tap water. [https://rumble.com/v2nh8xc-premiere-watch-the-water-2-closing-chapter.html]
At time 14:48 Ardis said: "The actual textilinin protein from the eastern brown snake prevents your body's plasmin from breaking down the blood clots. And it's published by them. We have created a self-assembling nanoparticle hydrogel that causes rapid blood clotting, rapid blood clotting. And it is resistant to plasmin being able to break it down, warfarin from being able to break it down - which is cuminin, a blood thinner - and it's also heparin resistant. And what did you find in every ICU with COVID-19 patients? They were heparin resistant. Why? They had ecarin in their body and textilinin." Then Stew Peters asked: "Is that what's causing these white fibrous things that embalmers are finding?" And Ardis replied: "1000% that's what's causing them." So Ardis said he was 1000% sure that the calamari clots were caused by two snake venom proteins.
At time 37:46 Stew Peters pointed out how Ardis was holding a vial with calamari clots when he spoke on the ReAwaken America Tour. And Ardis said they were clots he got from Richard Hirschman, and he again said that the clots are produced by a hydrogel that contains snake venom proteins. And he also talked about an Italian paper by Carlo Brogna et al. where the authors found snake venom peptides in the blood and urine of COVID patients.
At time 40:41, Ardis said: "Just January 28th of 2023, just a few weeks ago, Dr. Chetty MD out of South Africa - is working this entire time - I have been on Zoom calls with this guy for three years now, as we're learning about COVID, how to treat COVID, the success they're seeing in South Africa. Dr. Chetty is a great, honest, ethical human being. He has done phenomenal work. He stated in an interview on January 28th, 2023 - that in long-hauler COVID patients who are coming to his clinic from around the world - they couldn't get them better with traditional therapies they found worked with other COVID patients. So they ran fecal tests on them to find out is there anything in their body we're unaware of that would keep these people sick with long-hauler COVID symptoms?" Then the video cut to a clip where Shankara Chetty said: "At that point that we realized we need to look at stool samples. We need to - if it was found in sewage, and I couldn't understand why a virus found in sewage was not tracked backwards to the gastrointestinal tract where it arose, and to figure out what it was doing there. And so we managed to contact Carlo Brogna, who's done some very interesting work on coronavirus. Uh, what he very basically discovered with looking at stool samples was that the virus was replicating, somehow, in these stool samples, and the stools had toxins - protein-based toxins in them. He found with the incubation of the supernatant of this sample on fresh uninfected stool that the viral title rose exponentially and so the toxins as well. And so he proved bacterial phage activity, that this virus has the ability to infect the bacteria of your gut. And he found toxicities there, toxin-like peptides, which were akin to many different kinds of snake venoms, sea-snail poisons, shellfish poisons. And it's a wonder how those got there." Then Ardis said that one way venoms are manufactured synthetically is using bacteria like E. coli, and another way is using mammalian cells, so the mRNA vaccines also contain instructions that cause both bacteria and human cells to produce snake venom.
Shankara Chetty also wrote on Twitter that SARS-CoV-2 not only acts as a bacteriophage, but that it also modifies the DNA of bacteria through insertional mutagenesis to make bacteria produce snake venom. He also said that Tau Braun told him to keep an eye on snake venom in 2021: [https://x.com/ShankaraChetty/status/1900893736399217058]
Tau first mentioned snake venom to me in 2021 to keep my eye on. He understood that it was being experimented on to be weaponised and could be aerosolized etc. and spread, but I couldn't figure the transmission to other individuals by those affected. He planted the seed and asked that I don't disregard an envenomation as my treatment would address both Envenomation and Hypersensitivity. With the chronic gut issues we were seeing and a positive rectal PCR swab reported early on from China, we contacted Carlo Brogna, who was examining stool. What he found was that the virus had bacteriophage activity and infected the bacteria in your gut, replicating in them and getting them, through insertional mutagenesis, to produce toxins. These toxin like peptides resemble many different kinds of snake venom, conotoxins (sea snail venom), and starfish toxin.
That was the revelation that solved all my questions. Transmission of the toxin occurred through transmission of its code by the virus to the gut bacteria that then made the toxin. This allowed the toxic proteins to evade the hosts' digestive enzymes in the stomach and small intestine by being made directly in the colon where it can be absorbed unaltered.
UNNATURAL, INTENTIONAL, WELL PLANNED, TRANSMISSIBLE ENVENOMATION.
In order to insert DNA into a bacterial genome through insertional mutagenesis, I think SARS-CoV-2 would need to have reverse transcriptase. ChatGPT said:
SARS-CoV-2 is a positive-sense single-stranded RNA virus.
To cause insertional mutagenesis (i.e., inserting sequences into host DNA genomes), its RNA would need to:
- Be reverse-transcribed into DNA.
- Be integrated into the DNA genome of the host (e.g., a bacterium or a human cell).
This process requires:
- Reverse transcriptase: To convert RNA → DNA.
- Integrase (or similar enzyme): To insert the resulting DNA into the host genome.
Since SARS-CoV-2 lacks both enzymes, it cannot perform insertional mutagenesis on its own.
Chetty also tweeted: "Tau is one of my guardian angels, and an ex South African to boot." [https://x.com/ShankaraChetty/status/1900576881906200893] In Watch the Water 2 Bryan Ardis said that he had been on Zoom calls with Chetty for three years now. But there's not too many people in the COVID conspiracy movement who are as ridiculous as Tau Braun and Bryan Ardis.
Tau Braun is a "U.S. National Counterterrorism & EMS Advisor and Trainer", who has been a speaker at a bunch of emergency management conferences. [https://www.drtaubraun.com/about] In 2022 he told Jane Ruby that calamari clots are made of tissue that was programmed to grow snake venom glands by nanobots that used graphene oxide as a delivery mechanism. [http://web.archive.org/web/20221115233622/https://stewpeters.com/video/2022/11/the-jabbed-are-growing-animal-venom-glands-and-ducts/]
Shankara Chetty is Philip McMillan's sidekick who is frequently featured in videos on the Vejon Health channel. I started to think that McMillan was likely controlled opposition after he published several videos and posts where he promoted Greg Harrison's ORF hoax, but now that I know how his sidekick also promoted the story about snake venom, I have even more reason to suspect that McMillan is not sincere.
In 2023 Ana Maria Mihalcea said that Hirschman had sent her a sample of blood mixed with embalming fluid from a body he had embalmed, and she went on Maria Zeee's show to show microscope images of the sample. [https://web.archive.org/web/20230614195806/https://anamihalceamdphd.substack.com/p/my-interview-with-maria-zeee-bidens, https://rumble.com/v2u31yo-dr.-ana-mihalcea-bidens-universal-nanotechnology-vaccine-and-zombie-blood.html]
She didn't say if Hirschman received consent from the family members of the dead person for their blood to be paraded around by scammers (even though it's fairly likely that Hirschman didn't even send her a real sample of blood from an embalmed person).
She said that the calamari clots were made of hydrogel, but she also said that fiber-like structures she saw in the blood under a microscope were made of hydrogel. It reminded me of how Kevin McCairn says that the calamari clots are made of amyloidogenic peptides, but he also says that mystery fibers in his microscope images of blood samples are made of amyloidogenic peptides.
At time 31:07 Mihalcea showed the image below and said: "Just showing you these hydrogel classic ribbons that we've seen in the meat and the rainwater - we've seen them vaccinated and unvaccinated blood - and it's the same stuff that Clifford Carnicom and I looked at that also has functional groups that are consistent with hydrogel. And this is a close up. This is very similar to what Mike Adams saw in the microscopic analysis of the large clots, with this central, you know, hollow lining."
At time 40:56 Mihalcea said: "Look at this. All of a sudden, how is it possible that that the control of these blinking lights is creating the fluid to come out? This is exactly the process that David Nixon filmed to create a microchip, okay." And then Maria Zeee said: "Yes. And I mean, I watched that. People that have watched that have seen it. There's like that - there is a clear interaction between all of the materials forming, even to the point of what appears to be little robotic arms setting parameters, so that this part of the what appears to be a chip doesn't form. And it pulls, it looks like it's pulling out the rest to make the perfect shape." A year earlier Maria Zee had broken the news about how David Nixon found self-assembling robot arms in COVID vaccines. [https://zeeemedia.com/interview/world-first-robotic-arms-assembling-via-nanotech-inside-covid-19-vaccines-filmed-in-real-time-dr-nixon/]
At time 41:46 Mihalcea showed the image below, and she said it showed a hydrogel ribbon that was assembled out of blinking lights: "Are you able to see this filament here? Yes. Okay. So this 20 minutes later, that drop looked like this. It had built this hydrogel ribbon. And you can see that all of the surrounding blinking lights were actually used to create this thing. That wasn't there before. And this is the kind of hydrogel ribbons that we see in the blood 20 minutes to assemble this ginormous ribbon."
At time 50:59 Mihalcea said her sample also contained self-creating spheres: "So the entire blood area was filled with these kinds of spheres that were self-creating, and that had these small light particles in there that looked like they were emitting photonic light."
At time 1:07:45 Mihalcea said that calamari clots grow in the presence of a pulsed electromagnetic field, so an MRI scan might make the hydrogel clots grow bigger: "Well, uh, how about this? Um, so we've shown the pulsed electromagnetic fields, and just exposing the live blood of a vaccinated person - shows that the clot of this, the - the rubbery part of the clot, the hydrogel clot makes it grow. So how many people are getting an MRI scan, even the freedom doctors who are recommending an MRI for the heart to look for myocarditis? Is that making the hydrogel inside of them grow? So if you don't know that certain fields are affecting this technology and could have an adverse effect, and you don't even know it's in people, then you don't know how to take precautions. And so, uh, clinicians need to start learning about this. Because, again, you know, what if you make somebody's clot grow?" And next she said she had found microchips growing in dental anesthetics.
In this section I'm collecting images about the calamari clots I have posted on Twitter.
A FactCheck.org article about the Died Suddenly movie said the following: [https://www.factcheck.org/2022/12/scicheck-died-suddenly-pushes-bogus-depopulation-theory/]
Over the last year or so, Hirschman brought in people he worked with as a contract embalmer in Alabama. He knew three of the morticians who appeared in the video, he said.
One of them is Chad Whisnant, whose name is spelled incorrectly in the video.
Whisnant runs a funeral home in Alabama with his wife, Brooke.
He didn't return our call for comment, but Brooke Whisnant told us in a phone interview that the clots shown in the video aren't out of the ordinary and that she doesn't share her husband's view of vaccination, which has changed over the last several years.
"I'm now an antivaxxer," Chad Whisnant said in the video. "I wasn't before."
"It's been a slow, slow process ever since Trump took office," Brooke Whisnant said of her husband's shifting beliefs after former President Donald Trump took office in 2017. "It's been a very weird abyss of misinformation on the internet," she said.
The comments by Chad Whisnant's wife seem to indicate that Whisnant is himself a sincere conspiratard, which makes it seem less likely that he was some kind of a plant in the conspiracy movement who had been tasked with producing disinformation. But nevertheless it's interesting that even though his wife ran the funeral home with him, she said that the clots that were shown in the Died Suddenly movie were not out of the ordinary.
Chad Whisnant was featured prominently in the Died Suddenly movie, but I haven't found any other place where he has appeared in alternative media. Whisnant's name was misspelled in the Died Suddenly movie, but when I searched Twitter for the properly spelled form of his name in double quotes, I found only two tweets which referred to him. [https://x.com/search?q=%22Chad+Whisnant%22&f=live]
During Hirschman's debut interview he did with Jane Ruby, he said: "It all started - I can't put my finger on it - but probably around the mid, middle of last year." [https://rumble.com/vtcsgw-worldwide-exclusive-embalmers-find-veins-and-arteries-filled-with-never-bef.html?start=] In other early interviews Hirshcman similarly said he started seeing the clots around mid-2021, but later he changed his story to say he might have already seen the clots earlier.
Jane Ruby asked: "Mostly you're seeing them and pulling them from veins, not arteries. Is that correct?" [8:44] Then Hirschman answered: "Yes. But on this one here I also got one out of the artery as well. Which is unusual. I have here lately been pulling some out of arteries. I pulled one out of an artery last night." So he made it seem like the clots were more common in veins than arteries. However later on Hirschman started to say that the calamari clots were appoximately equally common in veins and arteries. For example in January 2023 when Chris Martenson asked Hirschman if the clots were coming out of veins and arteries "even-steven" (which means evenly matched), Hirschman answered "Yes, exactly." [https://rumble.com/v25vb6u-embalmers.html?start=1500] During an Hirschman did with Daniel Horowitz in February 2021, which I believe was Hirschman's third interview, he gave the impression that he saw the clots in veins at first and arteries later: "These clots are unusually firm. They're unusually long. Sometimes they're short. Sometimes they're long. They're just - sometimes it looks like they - that you can literally see how they're branching into different areas of the vein. But then I also started noticing them starting to appear in arteries, which is very unusual." [https://podcasts.apple.com/us/podcast/are-the-vaccines-causing-solid-frankenstein-blood/id1065050908?i=1000551322493, time 29:19]
But anyway, next Jane Ruby asked: "Was there any difference in what you observe from the one you pull from arteries compared to the ones you pull from veins?" [9:39] But Hirschman said: "The ones I pull from veins are much larger usually." That's another detail he may have omitted in his later interviews, even though I'm not sure.
Then Hirschman said: "They usually have that long strange whitish substance to it, usually a little bit of blood that's attached to it. Sometimes it seems like they're intermingled. It almost seems like the white grows almost out of the blood, as weird as that sounds. Some people are calling me - I call them worms, because to me they represent - they look very similar to the worms." Then Jane Ruby said: "Right, but we don't want to mislead people to think it's an animal, like a worm. You're just saying that it -." Then Hirschman said: "It resembles one sometimes, often with me, it resembles a worm. I've never seen one move on its own or anything like that. But it seems, it has the appearance of small worms. I've had someone that was in the embalmenting with me one night, and I was - there was a bunch of them coming out in the blood. And his words were, 'It looks like heartworms for people.' Not saying they were moving. I'm just saying these little stringy structures coming out of the blood." Then Jane Ruby said: "Now, are these structures that you're saying resemble like worm-like things - were they separate from the clot that started with the blood, and then the long piece coming out of them?" Then Hirschman said "usually they're together", and he said: "Usually I find a normal clot attached at one end at work, or I find them intermingled in with a clot. That's why I can rinse them out, and you can see the white structure."
A similar story that the clots resembled worms or parasites and they had regular blood clots attached to them was also told by Laura Jeffrey, the anonymous embalmer whose photos were shown by Jane Ruby, and the pseudonymous funeral director called Carolyn who was interviewed by Epoch Times.
A draft version of the Epoch Times article said: [https://docs.google.com/document/d/1Pbn3w73ZW04VJrg4DA7ZUzJWx2YPVJEZ75nkmk2pjRk]
While normal blood clots are dark brown in colour, Carolyn said the fibrous masses are white. But she said they also have a pinkish tone, as they are "literally feeding off of blood clots."
"They remind me of parasites, because they're creating a blood clot and they're feeding off it," she said. "So every tentacle is basically down a part of the circulatory system, and at the end of those fingers there is a normal clot, and it looks like they're feeding off it."
Hirschman also said that the fibrous clots appeared to be feeding off normal blood clots.
The Canadian embalmer Laura Jeffrey said: "I'm sort of like this and I see something that I thought was a tapeworm. Which was weird, because tapeworms shouldn't be in a circulatory system. And then I'm looking at this and I'm thinking, 'Is this a parasite?' Because a tapeworm's a parasite; that looked like a parasite. […] Then there's a blood clot that is integrated into the end of those tentacles. It felt like it was a parasite that was feeding off a blood clot that it created in the body. When you think of a parasite, you think - because it feeds off of something, right? Then you see the jelly clots at the end of this parasite. You see those and you think, 'Are they feeding off us as humans? Out of our circulatory system?' Because they always had the currant jelly integrated at the ends." [https://nationalcitizensinquiry.ca/wp-content/uploads/2023/08/TS2303TOR204-laura-jeffery.pdf]
At time 15:02 Jane Ruby asked Hirschman: "But before 2020, like from 2019 and earlier, you've never seen this specific type of combination clot. Is that what you're saying?" So she said the calamari clots were "combination clots", as if a distinctive feature of the clots was that they were attached to regular blood clots.
At time 2:36 Jane Ruby showed the image below, and she said it looked like a regular red blood clot on the right but it gradually turned "more and more white and fibrous" on the right side, and Hirschman also said it looked like a normal clot on the left side:
Two days after Jane Ruby interviewed Hirschman, she talked about the interview on the Stew Peters Show. She showed the image above and she said: "You can see on the far left of this picture, there is a red blood clot, which he said, 'When I touch it, manipulate it, like any blood clot, it does kind of disintegrate and melt, you know, melt away.' But as he moves down, and these are his words, not mine, he said 'This white fibrous piece that becomes the longer portion of it is very tough, it's stretchy,' he can't break it very easily, he said 'It looks like it's emanating out of the clot', and his words, 'It appears that it's kind of feeding on the blood and the clot.'" [https://rumble.com/vti2i0-embalmers-discover-horror-dr.-ruby-exclusive-arteries-filled-with-rubbery-c.html?start=112] Ruby also said Hirschman told her that "I've never seen this type of clot with a connection to the red portion and then this rubbery thing, before 2021". [4:12] So she seemed to emphasize how the white parts were connected to the red parts. She also showed this photo where there's red parts of a clot attached to white parts:
On March 13th 2022 Steve Kirsch published an interview of Ryan Cole. [https://rumble.com/vxeqvu-pathologist-on-ryan-cole-on-the-mystery-blood-clots.html]
At time 5:19 Kirsch asked: "When did you first start hearing reports of this?" And Cole answered that he first heard about the clots on the internet: "Uh, a couple months back, you know, I saw the pictures on the internet. A couple of friends had said, 'Hey, have you ever seen anything like this? Do you think this is real?' I said, 'Well, trust but verify is kind of how I work, you know, I observe. And then I do the science.' And so for me, it was like, okay, that looks interesting. It looks legitimate. But I'll believe it when I see it. And now I've seen it."
Then Kirsch asked: "The vaccines have been out for a year. How come you're only seeing this now? Or have people been seeing it before, and they're just not reporting it before - been too scared to report it?" [6:16] And Cole answered: "I think it's that fear factor. I think, I think you hit the nail on the head, because as I talked to some of these morticians, you know, this - I have two hypotheses on these. Number one, they were seeing it and they were like, huh, this is weird. And didn't think anything of it. Or it could be after one shot, you don't see a whole lot of it after two, you see more and after three, you see a lot. So it's really, it's the boosters that really started, uh, the punch here." But a problem with his explanation is that the morticians said the clots were already common before boosters.
At time 16:21 Cole showed the vial of a clot below, and he said the clot was about 12 inches long and he pulled it out of a big vein. And he said similar type of clots may have earlier occurred rarely due to genetic clotting disorders:
It was not clear why Cole even had the opportunity to remove a calamari clot from the body. But he may have been the first person who claimed to have seen a calamari clot but who was not a mortician.
However if Ryan Cole had an opportunity to see the clots through his work as a pathologist, and he was also talking to other pathologist, then why did he say that he first heard about the clots a couple of months ago on the internet?
One of many reasons why I think Ryan Cole is controlled opposition is that he was one of the very first people who started promoting the turbo cancer hoax. [turbo.html] The term "turbo cancer" was first introduced in September 2021 in Arne Burkhardt's pathology conference by a person who conveyed an anecdote about turbo cancer from Ute Krüger. Most of the earliest videos that match the term "turbo cancer" at BitChute are videos by the German pathologist Ute Krüger. But in a video that was published only 4 days after Burkhardt's pathology conference, Ryan Cole talked about how vaccines cause cancer, and he said: "I'll have a call later with three German pathologists. They're seeing similar signals. They're gonna be working on it as well. But it's based -. Another colleague in Dallas is gonna be working on it. We're trying to get a consortium of doctors together to study this." [https://rumble.com/vrnol2-dr.-ryan-cole-is-there-a-covid-vaccine-cancer-connection.html?start=917] The three German pathologists probably referred to Arne Burkhardt, Walter Lang, and Ute Krüger. In 2023 Arne Burkhardt was asked if there were other pathologists who had been able to confirm his findings, but the only pathologist he named was Ryan Cole. [https://www.thelastamericanvagabond.com/arne-burkhardt-interview-12-23-23/, 1:51:54] When Ryan Cole said he had a colleague in Dallas, he probably referred to the oncologist Ray Page, who was a speaker in a conference in Texas that was livestreamed by Epoch Times, where the speakers also included Ryan Cole, Peter McCullough, and Bryan Ardis. [https://www.youtube.com/watch?v=5gzEuYRKdJY&t=1h26m39s]
Ryan Cole's connection to AFLDS is also suspicious. In July 2021 Cole became a "Medical Director" of the Jew Simone Gold's organization America's Frontline Doctors. The news team of America's Frontline Doctors is run out of Israel by the Kahanist Chabadnik Mordechai Sones. [https://reinettesenumsfoghornexpress.substack.com/p/americas-frontline-doctors-all-roads] Sones also hosted the podcast of AFLDS which is now inactive, but during the last episode of the podcast he read out a letter by the Rebbe Menachem Mendel Schneerson. [https://soundcloud.com/aflds/letter-on-science-and-torah] Before COVID Mordechai Sones worked for Israeli mainstream media, and his LinkedIn profile says that in the 1980s he worked on "research in areas of how to upgade CIA covert arms pipeline to Afghans". [https://www.linkedin.com/in/mordechai-sones-bab8b916/]
When Ryan Cole's medical license was revoked, one of the charges brought against him was that he had prescribed ivermectin without obtaining proper informed consent on a telehealth website called MyFreeDoctor.com, which was affiliated with AFLDS. [https://lymescience.org/rogues/Ryan-Cole/Ryan-Neil-Cole-charges-and-findings-of-unprofessional-conduct-WA-2024.pdf] AFLDS was also affiliated with another similar telehealth website called SpeakWithAnMD.com, which offered prescriptions for ivermectin and the Zelenko protocol. It was launched in April 2020 by Jerome Corsi, who managed two mutual funds for B'nai B'rith, and in 2004 he told The Forward that "I've been a strong supporter of B'nai B'rith and Jewish causes for 30 years". [https://forward.com/news/5291/campaign-confidential-58/] A report about Corsi's website said that over a period of less than two months, the website earned about 7 million USD in consultation fees through customers referred by AFLDS. [https://coronavirus-democrats-oversight.house.gov/sites/evo-subsites/coronavirus-democrats-oversight.house.gov/files/2021.10.29%20Lettrer%20to%20SpeakWithAnMD%20re%20Misinformation.pdf]
In May 2025 Kevin McCairn wrote this about McKernan's preliminary analysis of the calamari clots: "Late-cycle amplification signals for SV40 promoter, spike protein coding sequence, and Ori (origin of replication) suggest low-abundance presence of residual plasmid DNA consistent with LNP-based recombinant vaccine components." [https://kevinwmccairnphd282302.substack.com/p/cadaver-calamari-amyloidogenic-fibrin] And he wrote: "These results indicate preliminary molecular evidence for incorporation or association of spike vaccine-related material within the clot matrices."
But two weeks later when McKernan published his sequencing results, he ended up debunking his own preliminary findings, because he didn't find a single read that aligned against either the Pfizer or Moderna vaccine spikes: https://anandamide.substack.com/p/whole-genome-sequencing-of-fibrin.
The reads that aligned against the Pfizer plasmid sequence aligned against components of the plasmid that matched human or bacterial reads:
When I did a BLAST search for the 300-base region after the spike ORF that had a large number of aligned reads in McKernan's alignment, it contained a perfect 141/141 base match to human mtDNA, which is included in the untranslated region after the spike as a stabilizing element. Similarly the region before the spike matched various human and mammalian cloning vectors, and ChatGPT said the region may have mimicked stable human transcripts like β-globin.
I have a hypothesis that some of the calamari clots might actually be fake clots that were created using a Chandler loop device, which is a device that circulates blood through a tube until a clot forms on the walls of the tube. If that is the case, some of the clots might actually contain blood from multiple people mixed together rather than blood from only a single donor. So I wanted to test if McKernan's reads contained DNA from multiple different people or only a single person.
But when I did variant calling for mtDNA haplotypes, I got a total of 50 variants with MAPQ score of 100 or above, which were all simple SNVs. And 47 of them are shared by the H10e1 haplogroup, which is found in Northwestern Europe and elsewhere in Europe: https://www.yfull.com/mtree/H10e1/. So it looks like there are not variants from multiple different haplogroups mixed together, or at least not variants that are frequent enough to get a high MAPQ score:
wget https://raw.githubusercontent.com/svohr/mixemt/master/mixemt/phylotree/mtDNA_tree_Build_17.csv
curl https://www.phylotree.org/resources/RSRS.fasta>rsrs.fa
sed 's/,*[^,]*,[^,]*$//;s/[()!]//g;s/ [ATCG]//g' mtDNA_tree_Build_17.csv|awk -F, '{a[NF-1]=$NF;o=$(NF-1);if(o=="")next;for(i=1;i<=NF-1;i++)o=o" "a[i];print o}'|gsed 's/ .*/ \U&/;s/ */ /g;s/ $//'>mtree
m2()(minimap2 -aY --sam-hit-only --secondary=no "$@")
m2 rsrs.fa Downloads/White_R1_001-fastp-filtered.fastq.gz|samtools sort -@2 ->clotmt.bam
x=clotmt;y=rsrs.fa;samtools index $x.bam;bcftools mpileup -f $y $x.bam|bcftools call -mv -o $x.vcf
awk '/^[^#]/&&$6>=100{print$2$5}' clotmt.vcf|awk 'NR==FNR{a[$0];next}{n=0;o="";m="";for(i=2;i<=NF;i++)if($i in a){n++;o=(o?o" ":"")$i}else{m=(m?m" ":"")$i};print n";"$1";"o";"m}' - mtree|sort -rn|cut -d\; -f-3|sed 3q
47;H10e1a;146T 4312C 10664C 10915T 11914G 13276A 16230A 152T 2758G 2885T 7146A 8468C 195T 247G 825T 8655C 10688G 10810T 13105A 13506C 16129G 16187C 16189T 4104A 7521G 3594C 7256C 13650C 16278C 769G 1018G 16311T 8701A 9540T 10398A 10873T 12705C 16223C 73A 11719G 14766C 2706A 7028C 14470A 16093C 16221T 13830C 47;H10e1;146T 4312C 10664C 10915T 11914G 13276A 16230A 152T 2758G 2885T 7146A 8468C 195T 247G 825T 8655C 10688G 10810T 13105A 13506C 16129G 16187C 16189T 4104A 7521G 3594C 7256C 13650C 16278C 769G 1018G 16311T 8701A 9540T 10398A 10873T 12705C 16223C 73A 11719G 14766C 2706A 7028C 14470A 16093C 16221T 13830C 46;H10e;146T 4312C 10664C 10915T 11914G 13276A 16230A 152T 2758G 2885T 7146A 8468C 195T 247G 825T 8655C 10688G 10810T 13105A 13506C 16129G 16187C 16189T 4104A 7521G 3594C 7256C 13650C 16278C 769G 1018G 16311T 8701A 9540T 10398A 10873T 12705C 16223C 73A 11719G 14766C 2706A 7028C 14470A 16093C 16221T
The 3 out of my 50 SNVs that were not shared by H10e1 were 3105A, 3106C, and 16124C. None of them are found in any haplotype in PhyloTree build 17. My only variant with a mapQ score below 100 was the insertion TCCCCC310TCCCCCC, which is part of a poly-C tract in a non-coding region that is prone to variation in length.
For some reason McKernan's own VCF file for the white clot has only 17 mtDNA variants. And out of them only 12 are simple SNVs, and only 4 of the 12 SNVs are shared by H10e1:
$ gzip -dc White-hs1-liftover.vcf.snpEff.ann.vcf.gz|grep ^chrM>temp
$ awk '{print$4$2$5}' temp
A263G
A302AC,ACC
A750G
A1438G
A4769G
GGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAA6789GCACA,*
GTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAA6798*,G
A6895*
A8860G
T10208.
T13830C
T14470A
A15326G
T16093C
T16124C
C16221T
T16519C
$ awk '{print$2$5}' temp|awk 'NR==FNR{a[$0];next}{n=0;o="";m="";for(i=2;i<=NF;i++)if($i in a){n++;o=(o?o" ":"")$i}else{m=(m?m" ":"")$i};print n";"$1";"o";"m}' - mtree|sort -rn|cut -d\; -f-3|head -n3
4;H10e1a;14470A 16093C 16221T 13830C
4;H10e1;14470A 16093C 16221T 13830C
3;H10e;14470A 16093C 16221T
I looked at the forward reads of the white clot sample. McKernan published reads for a white clot and a red clot sample, but I don't know if both of them are supposed to be novel types of clots that were not seen before 2021, or if one of them was a regular non-calamari clot that was used as a control:
In May 2025 Kevin McCairn published his second Substack post: https://substack.com/home/post/p-164383206. He is now supposed to have analyzed a sample of blood from a 3-years-old toddler, whose mother was supposedly vaccinated on weeks 32 and 34 of gestation, and who was born prematurely on week 35 of gestation and resuscitated at birth.
The post may have been partially generated by AI, because one of the section headings was formatted as Markdown. Substack doesn't even support writing posts as Markdown, but some AI utilities format copied text as Markdown:
McCairn's post has the air of cheap propaganda due to the emphasis on harm done to babies. A trope among alt media morticians is that they have a dramatic story to tell about dead babies, like how Wesley the funeral director said that there were about 10 times more babies dying than normally, so the fridges were packed full of dead babies. [https://dailytelegraph.co.nz/news/uk-funeral-director-there-are-10-times-more-dead-babies/] And Nicky Rupright King said that after the vaccine rollout, she saw new types of deformities in dead babies she had never seen before, and that "the deformities that these children had were astronomical". [https://www.bitchute.com/video/3Ev4bzcLuj4e/, 24:45] And the anonymous embalmer whose testimony was published by Laura Kasner wrote that they saw "an exponential increase in the number of fetal and infant deaths in 2021", and she saw babies that died of SIDS a few days after their breastfeeding mother received a COVID vaccine, and that "100% of the fetal and infant deaths that occurred in 2021 were born to vaccinated mothers". [https://laurakasner.substack.com/p/embalmer-testimony]
The emphasis of McCairn's post was on scary microscope images, which is reminiscent of content by the Quinta Columna and Stew Peters crowd. ChatGPT said this about McCairn's post: "This document strongly resembles pseudoscientific or hoax material, exploiting scientific-sounding language and visual data without meeting the necessary standards of scientific proof."
McCairn showed these images of a mystery fiber he found in the 3-year-old's blood:
He also showed images of a second similar fiber, and he described the fibers he showed as "autofluorescent fibrillar structures" and "UV-reactive fibrillar microclots" and "amyloidogenic fibrin microclots".
Individual strands of fibrin have a string-like shape, because because their purpose is to form a criss-crossing mesh that traps red blood cells and that covers a punctured blood vessel. Some large blood clots have a string-like shape because they conform to the shape of a blood vessel. But that doesn't mean mini clots that are randomly floating around in the blood would also have a string-like shape, unless for example they formed inside a small blood vessel and then got dislodged.
Strands of fibrin typically have a diameter of about 0.1 µm, which is about 50 times smaller than the "fibrillar structures" shown in McCairn's images.
When Ana Maria Mihalcea sees a fiber-like object under a microscope, she declares it to be a Morgellons filament or a carbon nanotube. If McCairn sees the same object, he says it's a baby calamari clot, an amyloid fibril, or an amyloidogenic peptide. He previously claimed that this structure with a diameter of about 10-20 µm was an amyloid fibril, even though in reality amyloid fibrils have a diameter of about 5-20 nm:
McCairn also described this structure as a "fibril" (which I believe he claims to have found in the blood of a vaccinated person): [https://synapteklabs.com/protocol-on-sending-blood-samples-2/; https://discernable.io/confirmed-evidence-of-biological-engineering-and-novel-clotting-with-dr-kevin-mccairn/, time 2:22:25]
The structure in the image above is shown to be about 15 µm wide. But the word "fibril" usually refers to structures with a diameter in the nanometer scale, like amyloid beta fibrils which are typically 7-13 nm in diameter, or collagen fibrils which are typically 50-500 nm in diameter. The object in McCairn's image also has two features that are not consistent with a clot that has an elongated shape because it formed inside a blood vessel and got dislodged from the vessel, because the object is flat and wide, and it has a fold that runs along the middle lengthwise.
McCairn supposedy does his blood analysis using slides of blood mailed by his followers that contain only a small amount of blood, even though it's not clear if that's how he received the blood of the 3-year-old. I pointed out that if he keeps finding baby calamari clots in random samples of blood with a small volume, there should be vast fleets of baby calamari clots swimming around in the bloodstream of people. But he refused to even answer me what volume of blood he analyzed: [https://x.com/KevinMcCairnPhD/status/1927142276217581798]
The Twitter user Markus pointed out McCairn said one of his microscope images was taken at a 4-fold magnification, but the scale bar seemed to indicate it was taken at a much higher magnification level: [https://x.com/mar15164/status/1927071726300451325]
ChatGPT said that typically "the field of view (FOV) for a 4x objective on a standard microscope with a 10x eyepiece is around 4–5 mm (4000–5000 µm)", but McCairn's image showed a width of only about 550 µm, which is only about 12% of the typical FOV:
But McCairn said he didn't even use an eyepiece, so the FOV at 4x magnification should be about 40-50 mm, which means that the visible width of his image is only about 1.2% of a typical FOV.
When I asked ChatGPT if an eyepiece can go up to 100x, it said 100x eyepieces are extremely rare and not practical for most applications, and typically eyepieces only go up to about 15x or 20x magnification. When I asked what could explain McCairn's narrow FOV if the image was taken without an eyepiece, ChatGPT wasn't able to give any reasonable explanation. But it did say it was possible that the scale bar was wrong or the magnification level was reported incorrectly.
McCairn replied to me: "The field of view is not 0.5mm you cretin, the scale bar shows the pixels derived from the camera using a calibration slide placed on the slide holder. you are looking at an amyloidogenic fibril that is 100's of micrometers in length and the scale bar in red shows 50 micrometers not 0.5mm you moron". [https://x.com/KevinMcCairnPhD/status/1928562639476764916] But I replied: "The scale bar is about 9% of the width of the image, and 50/.09 is about 550 µm. The field of view means the width visible in the image." And McKernan said: "Again you're wrong about calibrating the scope. And thread sliding trying to get away from the amyloidogenic clot data." But I replied: "How am I wrong? Is the field of view not about 0.55 mm? If you didn't even use an eyepiece, then how do you explain that your FOV is only about a hundredth of a typical FOV at 4x magnification without an eyepiece?" Then McKernan said: "No it isn't go back to your calculations and think how a stained amyloid structure which by the scale bar is close to 1mm in length fits in that FOV." But I replied: "The scale bar is 94 pixels wide, the image is 1047 pixels wide, and 94/1047 is about 0.090. The area of the fiber is about 765 by 260 pixels, and (765^2+260^2)^.5/94*50 is about 430 µm (but the fiber is not perfectly straight, so you can round the length up to 500 µm)." But after that he just replied "Science is moving on henjin" and linked to his new Substack post. But I told him: "You still haven't explained why the FOV is only about 550 µm if the image is taken at 4-fold magnification." But he said: "lmfao how is the fov 0.5mm, tell you henjin, get a scope, get a calibration reticle and see what you come up with. And the amyloid data is pouring in, suck on my big, fat, juicy 'fibril'. Feel its scale invariance pounding your tiny sperg hole!" And I asked: "Well what is the FOV then, and how are you supposed to calculate it? Is my calculation of 1047/94*50 wrong?" Then another user replied: "have you ever heard of something called cropping?" And McCairn answered: "These things would be beyond henjin, in his dos, html world." But I replied: "So your explanation for why the FOV is about 1% of a typical FOV at 4x magnification is that the image was cropped? Did the original image display a 100 times wider area but you cropped about 1% of the width of the image?" He didn't answer, but when I later asked the same question again, McKernan said: "Irrelevant sperg detail, when you have the image across 2 different methods and concordance. Simple fact is you have a large amyloid fibril detected, in the blood, that would fill clinical criteria for a clot. From nano to macro, the presentation is parsimonious." [https://x.com/KevinMcCairnPhD/status/1929183581537968191]
He referred to an SEM image of the same fiber-like object he had now posted on Substack. [https://substack.com/home/post/p-164833000] His SEM image was taken at 40-fold magnification, but the object in the image now took up about 50% of the FOV: [https://substack.com/home/post/p-164833000]
So why did the same object take up about 75% of the FOV in the other image that was supposedly taken at 4-fold magnification?
The object in the new SEM image is about 731 pixels wide, and the 1 mm scale bar is about 460 pixels wide, so the width of the area covered by the object is about 1.59 mm. But in the earlier optical microscope image, the width of the area covered by the object was only about 0.38 mm based on the scale bar.
Jikkyleaks asked: "Kevin are your scales correct on the SEM pic? In the first picture it looks like that fibril is about 500micrometres long, but the SEM scale is marked in millimetres." [https://x.com/Jikkyleaks/status/1928634205245690299] But McCairn answered: "Yes they are dead on accurate, you are looking at the difference between trying to calibrate off a glass slide reticle that comes from some Chinese sweat shop vs. the precision delivered by top off the line SEM. The scales are within the margin of error between the techniques deployed."
I don't know what the ring with the segmented pattern in the SEM image is, but the segments might be due to dessication. Before he took the SEM images of the supposed microclot from the 3-year old, he is supposed to have done ThT staining for the sample. Earlier when I asked what the pattern that looked like cracked glass was in the image below, McCairn said it came "from the dried solute after adding ThT": [https://synapteklabs.com/protocol-on-sending-blood-samples-2/]
But anyway, I still didn't have an answer to the question of the old microscope image had a FOV of only about 0.55 mm even though it was supposed to be taken at 4-fold magnification. So I asked McCairn: "So was your 4x image cropped or not? If so then what percentage of the width of the original image did the cropped image show? It's probably not nearly enough to explain why the FOV was only about 0.55 mm even though a typical FOV at 4x magnification would be about 40-50 mm." [https://x.com/henjin256/status/1929207032516637023] He posted a reply where he didn't answer my question, so I asked him again: "Was the image cropped or not? It should be a simple question to answer. Or did you use something like a tube lens or digital zoom?" I referred to this tweet by Markus: [https://x.com/mar15164/status/1929215136167776643]
I suspect there's a tube lens and/or other optical components of the camera setup that provides most of the missing magnification, rather than just cropping/digital manipulation.
per AI :
But McCairn still didn't answer my question: [https://x.com/KevinMcCairnPhD/status/1929222987800334487]
I have joined Kevin McCairn's Discord server multiple times since 2020, and I was even made into a moderator on the server at one point, but I have usually left the server after a while because it had a very low quality of posts. McCairn banned me from the server in May 2025, because I said that the calamari clots were fake and that he was probably controlled opposition.
McCairn has said since his earliest videos that he almost died after he got COVID from the Korean superspreader event in Daegu. He said he had severe neurological symptoms, which was a reason why he knew early on that COVID had a neurotropic effect and why he decided to focus on researching the neurological aspects of COVID.
However the problem with his story is that the Korean superspreader event occurred in February 2020, but McCairn says that he was in Daegu from late November into December 2019. I haven't seen anyone else call him out for his claim until I brought it up on his Discord:
I used to think McCairn probably had some other illness but he mistook it for COVID, but after I found out how there's also many other people in alt media who claim that they were among the first people who got COVID in their country, I started to think it's possible that he just made up the whole story about having COVID.
It also seemed like an unlikely coincidence that McCairn was an early YouTube streamer who was focused on COVID, but he also happened to be at the right place at the right time to get infected with COVID very early on. Often if a fabulist invents an embellished biography for themselves, they insert themselves in various locations over the world at a time when some event of historical importance happens to occur at the location. But the Korean superspreader event was probably the internationally widest known event that occurred in Korea in the entire year of 2020.
In the unlikely scenario where McCairn is not lying and he was actually infected with COVID in November or December 2019, he might have been the first person with COVID in Japan, because he claims that he was still sick with COVID after he returned home to Japan in December 2019.
In the screenshot above I pointed out how Steve Pieczenik claimed that he was the first case of COVID in the United States, and he claimed that he got COVID after he met with a Chinese student from Wuhan (because I guess he didn't count the student as an earlier case of COVID in the United States). [https://www.bitchute.com/video/Dq8v0zZpVCCe/, 22:08] But how did Pieczenik even know what city the student came from? At the time Americans were not yet familiar with Wuhan, and it wouldn't have meant much to Americans what Chinese city the student came from. And similarly John Mark Dougan lives in Russia where there's only about 20,000 Chinese people in the entire country, but he claimed that he got COVID after he went to an immigration office where he saw Chinese people wearing masks. So in the same way that Pieczenik happened to conveniently come in contact with a student from the right Chinese city, and Dougan happened to convenently come in contact with Chinese people in a country where there's almost no Chinese people, McCairn also happened to conveniently visit the right city in Korea at the right time so he could catch COVID.
I don't know if McCairn actually even visited Daegu in 2019 like he claims, but in one video he also said: "I got hit by the biggest superspreader event in Asia, right early on, in November to December." [https://rumble.com/v6sfp5f-episode-174-spike-induced-brain-injury.html?start=3776]
Kevin McCairn's sidekick Charles Rixey also claims that he was one of the first people in the United States to have COVID: [https://sites.google.com/housatonicits.com/home0009/research/earlycovidsurvivors]
I wrote about the topics covered in this section in more detail here: yt.html.
Kevin McCairn's website has a section for links to streams and websites that are related to his stream, which used to have links to J.J. Couey, Mark Kulacz, Charles Rixey, and a guy on McCairn's Discord who often goes on his streams, even though at one point McCairn removed the link to Couey's website. [http://web.archive.org/web/20230329103032/https://www.mccairndojo.com/] McCairn, Couey, and Kulacz were all early YouTubers who were focused on conspiracy content about COVID, and they were all featured in early 2020 in video panels hosted by Addy Adds.
I first found out about Kevin McCairn in early 2020 because he was a guest on Paul Cottrell's YouTube channel. It was one of the very first videos McCairn did in alt media.
McCairn was later also featured in the first episode of Paul Cottrell's Coronavirus War Room together with George Webb, and McCairn and Cottrell also participated in a series of video panels hosted by Addy Adds. Addy Adds functioned as a mini-me of George Webb for a while, he coauthored multiple books with George Webb, and he did several videos in person with George Webb. He even called himself a citizen journalist like George Webb, Jason Goodman, and Mark Kulacz. J.J. Couey was first introduced to Mark Kulacz by McCairn, because McCairn asked Couey to join the panels hosted by Addy Adds, which also featured Kulacz who used to be part of George Webb's crew of citizen journalists.
George Webb also did a lot of videos with Paul Cottrell, who was Webb's go-to guy on COVID science and Webb's biology teacher. Webb actually managed to learn an impressive amount of details about the biology of COVID from Cottrell.
George Webb has said that he shared an apartment in New York with a spy lady who worked as a caterer at Epstein's parties and who secretly videotaped the parties. [https://www.youtube.com/watch?v=iFxnxWCBu6I&start=1m39s, https://burners.me/2019/07/28/larpwars-part-2-moving-the-goalposts/] He has also said that he has homies at French Mossad. [https://www.youtube.com/watch?v=dKBC3gChmKQ] In one video he listed his intelligence connections, and he said "when you start way smarter than your IQ, there's a good chance there's an intelligence person behind you making you smarter". [https://www.pscp.tv/webb4bernie/1ynKOjWpwBVxR?t=16m41s]
George Webb has also said that he worked with Dutch intelligence in New York. [https://www.pscp.tv/webb4bernie/1ynKOjWpwBVxR?t=10m55s] He wrote a book about Erasmus Medical Center in Rotterdam, which is where J.J. Couey used to work, and George Webb was also the main person in alt media who covered a mass shooting at the Erasmus Medical Center. George Webb used to be the sidekick of Jason Goodman, whose current sidekick John Cullen speaks Dutch (which is another interesting Dutch connection in this circle, even though it might be a coincidence). [https://x.com/search?q=from%3AI_Am_JohnCullen%20lang%3Anl&f=live]
Couey tweeted: "Even crazier when you realize that my first ever live streams of any kind were invites to join Paul Cottrell of Operation George Webb, Addy Ads of Operation George Webb, and McCairn…five weekends in a row. McCairn had a solo stream with Ads-Webb one week before. All in on it." [https://x.com/jjcouey/status/1827727108979724547] But Couey leaves out how his BFF Mark Kulacz was also part of the same circle surrounding George Webb.
In early 2020 both Kulacz and Webb presented a theory that SARS-CoV-2 was created in Fort Detrick by Sina Bavari, even though I don't know which one of them came up with the theory first. In 2019 before Kulacz had started his own YouTube channel, he did his alt media debut on a channel that was launched by George Webb together with John O'Loughlin, who is the son of a high-level FBI agent. [https://x.com/leytedriver/status/1171849929427472384, https://x.com/leytedriver/status/1100400815032934404, https://x.com/HousatonicLive/status/1742404612819210380] Webb did many videos together with O'Loughlin in person, because they both lived in the DC area, which perhaps not coincidentally is where the headquarters of the FBI, CIA, and NSA are located. O'Loughlin is a retired lawyer who was a member of the DC Bar Association.
Mark Kulacz worked as a "competitive intelligence director" at the company Datto, which made the news in 2015 after the FBI seized a backup server of Hillary's emails that was managed by Datto. In 2019 Mark Kulacz came out as a whistleblower about Datto's role in the email scandal, even though most of what he said was already public information. [https://www.youtube.com/watch?v=xTpvuAf-_jI] At first I thought his big revelation was that the email server was personally seized by Peter Strzok from the FBI, but Kulacz seems to have copied the claim about Strzok from an anonymous user on Twitter who presented poor evidence for the claim. [http://web.archive.org/web/20180120165625/https://x.com/HousatonicITS/status/954173497168875520] But regardless, Kulacz's past as a whistleblower is interesting, because Hillary's emails were one of the main topics that George Webb focused on before COVID, and Webb had a unique theory that part of the emails were leaked by Eric Braverman who was the CEO of Clinton Foundation.
After Kulacz started his YouTube channel in 2019, the first guest on his channel was a lawyer from DC whose father was a high-level FBI agent, and the second guest was Patrick Bergy who worked as a cyberwarfare expert for the military contractor Dynology. [https://sites.google.com/housatonicits.com/live/episodes] Steve Outtrim wrote: "Like so many 'ex' intelligence people, Patrick Bergy got his alt-media start on Jason Goodman's 'Crowdsource the Truth' channel. Soon after he was interviewed by George Webb, and soon after that he filed his 'qui tam' lawsuit". [https://burners.me/2020/08/18/millie-freed-illuminati-recruiter-defango-maga-coalitions-biggest-donor/] However the third person in alt media I found who interviewed Patrick Bergy was Mark Kulacz, who also calls himself a citizen journalist like Webb and Goodman.
Bergy is also one of the few people in alt media who has done an interview with Thomas Schoenberger, and Bergy has even used Schoenberger's music as background music in his livestreams. [https://rumble.com/v29akrm-the-american-awakening-special-edition-thomas-schoenberger-interview-on-mat.html]
In April 2020 George Webb's brother reported that Jason Goodman had declared a cyber war against Cottrell because Cottrell appeared on Michael Decon's radio show together with Schoenberger. [http://web.archive.org/web/20200419220724/https://sdny.news/2020/04/03/conspiracy-theorist-jason-goodman-launches-into-fake-quack-doctor-paul-cottrell-in-epic-social-media-stereo-rant-after-thomas-schoenberger-video-surfaces/] During the show Schoenberger said that he had been following Cottrell's channel since mid-January, and Cottrell was a blessing and he was making a huge difference. [https://www.podchaser.com/podcasts/the-michael-decon-program-217641/episodes/dr-paul-cottrell-thomas-schoen-54538334, time 36:10] Both Schoenberger and Cottrell call themselves polymaths, but the Cicada 3301 member Marcia Stockton also calls herself a polymath. [https://x.com/AlphaUnseen/]
Thomas Schoenberger made a video about the origins of Q, where he said that in 2017 before the first Q drop had been released, he created a Q puzzle which was part of a Cicada 3301 puzzle called Sevens.Exposed. [https://www.youtube.com/watch?v=64CBZbzgbwI] An official website of Cicada 3301 has a list of their alumni which consists of three people, who are Bruce Cooper Clarke Jr. who was the director of the Office of Strategic Research at the CIA, Iona Miller who is a researcher of the Count of St. Germaine, and Ian Murdock who created Debian Linux. [https://www.cicada3301official.com/pages/alumni.html]
Iona Miller's husband Richard Alan Miller has been featured as a guest of the Leak Project and Oppenheimer Ranch Project channels on YouTube, which were the first two channels I found where Paul Cottrell ever appeared as a guest, and in fact Cottrell and Richard Alan Miller appeared as guests on consecutive episodes of Oppenheimer Ranch Project in February 2020. [https://www.youtube.com/playlist?list=PLJHy6u5Yrwd5lVj0KJnz-i6ubTAPg6CcV]
Paul Cottrell has a backup channel on YouTube called Abraham Lincoln. It includes only a single video, which is a video uploaded in 2015 that consists of a still image of the logo of Cicada 3301, and if you download the video and create a spectrogram image of the video, it contains a hidden message signed "3301". [https://www.youtube.com/watch?v=bCmKGFTEO2g] In the comments of the video there is a hint on how to proceed in solving the puzzle further, but I didn't figure out what the hint meant.
Paul Cottrell also posted a video on his main channel where he took a screencapture of his Abraham Lincoln video. In the comments someone asked "What is this?", but Cottrell replied "forward operations", and when someone else said it was a puzzle, Cottrell replied "much more than a puzzle my friend". [https://www.youtube.com/watch?v=6IRNXFCOV8s, i/yt-cottrell-cicada-3301.jpg] When I searched for the term "forward operations" in double quotes on Google, most results were about something called "defend forward operations" or "hunt forward operations", which are terms that are used in the context of cyber warfare and which refer to defensive cyber operations.
In addition to the Cicada 3301 video, Cottrell also posted a second cryptic video that only consisted of text that says "STONEHENGE 4-10-4" and no audio. [https://www.youtube.com/watch?v=4oEBLAuVRj0] Someone posted this comment to the video: "Hello. Just to say coincidentally there is a skeleton at Stonehenge that was tagged as no. 4-10-4. He was decapitated and it was rumoured that it may have been king Arthur." It sounds like something from a Cicada 3301 puzzle, because they often involve historical artifacts or themes like the Grail legend.
In February 2020 Paul Cottrell posted a short video where he showed a tweet by Voice of Guo Media, which said that at a critical moment on June 4th, Miles Guo's people would go against the top level of the CCP. Then Cottrell said: "This is code. This is a CIA code for an operation. And what's happening is you take six for June 4th, 2020, okay. Cause that's the date that he's mentioning. Take the six for June divided by two, you get three. You take the four for the date divided by two, you get two. You take 2020, which is two plus zero plus two plus zero is four. Divide it by two, it's two. When you take those answers from those ratios, it adds to three, it makes three, two, two. That is the sign. That's the code that the CIA operation is happening. There is a takedown of the CCP and this was the launch code." [https://rumble.com/v6eic01-feb-4-2020-paul-cottrell-voice-of-guo-media-coronavirus-cia-steve-bannon-em.html] I don't know how he was able to tell that 322 was code specifically for CIA. But anyway, the video was so ridiculous that there's no way Cottrell believed it himself, so it seemed like deliberate disinformation.
In February 2020 Paul Cottrell became known as "the American whistleblower" in China after one of his YouTube videos went viral in China. [https://www.baidu.com/s?wd=%22paul+cottrell%22&gpc=stf%3D1580508000%2C1583013600%7Cstftype%3D2] In the video Cottrell said that a follower of his YouTube channel had contacted him on Facebook and sent him screenshots of text messages he received from someone at the CDC, who said that the CDC was hiding the true number of COVID cases in the United States. [https://www.bilibili.com/video/av91204053/] The screenshots were probably fake because they showed the name of the sender as "Nancy Messonnier (CDC)", even though they were screenshots of the Messages application on iOS which only displays the first name of the sender. [https://x.com/benplowman/status/1231447635338264576/] However the same screenshots had been published a few days earlier by the radio show host Hal Turner, who said that the text messages were not leaked by the person who received the text messages, but by his 18-year-old son who took the screenshots on his father's phone. [http://web.archive.org/web/20200217063226/https://halturnerradioshow.com/index.php/en/news-page/news-nation/alleged-c-d-c-text-messages-say-over-1-000-infected-with-coronavirus-in-u-s-a-being-deliberately-concealed] When someone on a Chinese website asked if Paul Cottrell's video was legit, another user linked to Hal Turner's website and indicated that it supported Cottrell's story. [https://www.zhihu.com/question/373999679]
Hal Turner worked as an FBI informant according to testimony in court by his lawyer and himself. [http://web.archive.org/web/20080118203302/http://www.recordonline.com/apps/pbcs.dll/article?AID=/20080117/NEWS/801170326/-1/NEWS, https://archive.ph/soTD7#selection-505.0-512%2e0] He even ran a Nazi rally for the FBI in New York. [https://x.com/HeadlineUSA/status/1807032673942020181] In 2008 Hal Turner was plotting a feigned sequel to the Oklahoma City bombing together with a patsy he was working with. [https://headlineusa.com/fed-files-iii-fbi-informants-phony-obama-truck-bomb-tip-spurred-federal-probe/]
In 2010 Hal Turner told the New York Times that he "answered the call of the federal government to infiltrate the white supremacist movement", and he said that his racist persona was fake, and he told people to "be confident that the person you hear on radio is not real life". [https://www.nytimes.com/2010/03/04/nyregion/04hal.html] Paul Cottrell and Kevin McCairn are both livestreamers, which is basically the modern-day equivalent of shock jocks on talk radio like Hal Turner. McCairn makes fun of Stew Peters, but McCairn occupies a similar niche as Stew, because they are both shock jocks who have combined coverage of COVID with antisemitic content. Stew Peters serves a purpose of making antisemites look ridiculous, but McCairn also makes antisemites look like some kind of juvenile memetic warriors, and his knowledge about the Jewish question is very superficial.
In February 2025 a user on McCairn's Discord wrote "Hal is making some changes thanks to Kevin's comment", and the user linked to a blog post where Hal Turner announced that he made his show shorter on Wednesdays and he was going to spend less time on taking calls from his listeners. [i/clot-hal-turner-changes.png] When I asked why Kevin McCairn commented on Hal Turner's radio show, I didn't get an answer from either McCairn or the user on his Discord.
Kevin McCairn is in his fifties, but he has positioned himself as a memetic warrior on the internet, and he and his followers make memes that include characters like Pepe the Frog and Wojak. Mike Benz used to have a fake white nationalist channel on YouTube called Frame Game Radio, which he said was part of a project by Jews to infiltrate the antisemitic movement. [https://x.com/MikeBenzCyber/status/1710479185028726943] The Twitter account of his white nationalist persona reminded me of McCairn, because Benz's profile picture was a Wojak wearing a Pepe hoodie, and his bio said that he was a veteran of memetic wars and that he "melded metals into memetic ammo". [https://web.archive.org/web/20170825221401/https://twitter.com/FrameGames] But both Benz and McCairn seem too old to be posting 4chan memes.
To my knowledge Kevin McCairn has coauthored two scientific papers about COVID. One of them was a paper he wrote with Richard Fleming, where they described a stunt where they filmed blood under a microscope while they applied drops of a COVID vaccine on the blood. [https://medwinpublishers.com/article-description.php?artId=9730] And the other paper was a review about COVID origins by several members of DRASTIC, who included Dan Sirotkin and J.J. Couey. [https://link.springer.com/article/10.1007/s10311-021-01211-0]
I first found out about J.J. Couey because his YouTube channel was linked at the top of a blog post by Dan Sirotkin. [https://harvardtothebighouse.com/2020/01/31/logistical-and-technical-analysis-of-the-origins-of-the-wuhan-coronavirus-2019-ncov/] Couey discussed the blog post in his first two YouTube videos about COVID. Dan Sirotkin describes himself as a "former NSA counterterrorism analyst", but as of 2024 he still lived in the DC area where the headquarters of various intelligence agencies are located. He is also a Jew like George Webb and Paul Cottrell. [https://x.com/Harvard2H/status/1425424404591284231, https://x.com/Harvard2H/status/1298767738811318272, https://x.com/Harvard2H/status/1603861877993476097] Couey tweeted: "Before DRASTIC existed, there was an original duo…Dan and his dad. And then I found them, and we became three. DRASTIC was after this." [https://x.com/jjcouey/status/1401262466978488320] So Couey was basically the third member of proto-DRASTIC after Dan and Karl Sirotkin. I believe McCairn has never been an official member of DRASTIC, but for example the intro and outro videos for his streams have been done by FunctionGain, which is likely an alter ego of Billy Bostickson who founded DRASTIC. [https://x.com/KevinMcCairnPhD/status/1677539890370859009, https://x.com/BillyBostickson/status/1653490934372528129, https://drasticresearch.org/drastic-tv/, https://www.youtube.com/watch?v=yfG4X-vV5XU]
Christie Laura Grace is another one of the many suspicious people McCairn is connected to. In May 2025 she appeared together with McCairn on a podcast about the calamari clots. [https://discernable.io/confirmed-evidence-of-biological-engineering-and-novel-clotting-with-dr-kevin-mccairn/] Her pet topic is LNPs so she says the calamari clots are caused by LNPs (in the same way that Geoffrey Norman Pain says the clots are caused by endotoxin, and Bryan Ardis says the clots are caused by snake venom). McCairn wrote "I have covered the LNP's and their propensity for abnormal clots with Christie Grace on stream multiple times." [https://x.com/KevinMcCairnPhD/status/1801412652650103294] In 2023 McCairn, Rixey, and Grace were featured in a video panel hosted by Philip McMillan, who seems like a disinformation agent because of his involvement in Greg Harrison's ORF hoax. [https://www.youtube.com/watch?v=pYCjFViwBWw] Grace has said that she "recorded experimentation on people" using equipment she received from Project Veritas, because she was going to be a whistleblower for Project Veritas. [i/christie-laura-grace-project-veritas.jpg] Her story was never released, but nevertheless Project Veritas is transparently a controlled opposition outlet, so it's suspicious how Grace was going to be one of their whistleblowers.
One of McCairn's biggest cheerleaders on Twitter is CatsRule2023/RexesRule. She has made a lot of meme-style images that promote McCairn, and she often asks people to donate money to McCairn. Her banner image on Twitter has text that says "NAVSECGRUDIV" and "NAVCAMSEASTPAC". She posted a tweet that said "My NAVSECGRU team was the best", and when someone asked "SEAL?", she replied: "Sorry, no. Spook here. Love the Seals, though. How about you?" [https://x.com/CatsRule2023/status/1863653354909389166, https://archive.is/tZhov, https://archive.is/2gCXL] NAVSECGRU was a branch of naval intelligence that that was also part of the NSA's Central Security Service. An announcement from 2005 said: "What was formerly NAVSECGRU has now become NETWARCOM's Information Operations Directorate." [https://coldwar-c4i.net/NSG/NNS051005-04.html] The announcement also said: "The IO warfare area is composed of five core integrated capabilities: Electronic Warfare, Computer Network Operations, Psychological Operations, Military Deception and Operational Security." So I asked RexesRule if she worked for the deception capability or psyop capability of NAVSECGRU, but she didn't answer me.
I have pointed out to McCairn that individual fibrils of fibrin have a string-like shape because their purpose is to form a mesh that traps red blood cells. And large blood clots have an elongated shape because they conform to the shape of blood vessels. But that doesn't mean that intermediate-scale formations of fibrin would also have an elongated string-like shape, unless for example they formed inside a small blood vessel and then got dislodged from the vessel.
When McCairn looked at a sample of blood from a 3-year-old under a microscope, he supposedly found this mini calamari clot with a diameter of about 5 µm and length of about 500 µm: [https://kevinwmccairnphd282302.substack.com/p/amyloidogenic-fibrils-in-a-post-gestational]
Now in his third Substack post McCairn provided the following explanation for why his mini clot had a string-like shape: "These comparisons between nano- and macro-structures highlight the conserved geometry of pathological amyloidogenesis. This scale-invariant preservation of fibrillar architecture aligns with prior biophysical studies demonstrating that amyloid formation follows universal thermodynamic pathways, forming twisted ribbon-like or lamellar structures irrespective of protein species or environmental origin (Chiti & Dobson, 2017; Eisenberg & Sawaya, 2017). The similarity across scales - from nanometer-thick fibrils to centimeter-scale clots - suggests a deeply encoded biophysical template likely seeded by persistent amyloidogenic peptides, such as SARS-CoV-2 spike protein."
However I'm not convinced by his explanation, and I didn't find any part in the two papers he linked that would've explained why amyloid formations on the micrometer scale would have a string-like shape.
When I asked ChatGPT to describe the shape of common types of amyloid formations in the human body on the micrometer-scale, it gave me the following list:
1. Aβ (Alzheimer's)
- Shape: Dense plaques (spherical, irregular, starburst)
- Size: 20-200 µm
- Location: Extracellular (brain cortex, hippocampus)
2. Tau (Alzheimer's, FTD)
- Shape: Neurofibrillary tangles (flame-shaped, globose)
- Size: 10-50 µm
- Location: Intracellular (neurons, dendrites)
3. α-Synuclein (Parkinson's, LBD)
- Shape: Lewy bodies (round with halo), neuritic threads
- Size: 10-25 µm
- Location: Intracellular (neuronal soma, axons)
4. Transthyretin (TTR, Amyloidosis)
- Shape: Linear, patchy, or amorphous deposits
- Size: 10-100 µm
- Location: Extracellular (heart, nerves, GI tract)
5. Light Chains (AL Amyloidosis)
- Shape: Nodular, perivascular linear deposits
- Size: 20-200 µm
- Location: Extracellular (kidneys, heart, tongue)
6. IAPP / Amylin (Type 2 Diabetes)
- Shape: Sheet-like or intercellular ribbon deposits
- Size: 10-50 µm
- Location: Extracellular (pancreatic islets)
7. Serum AA (Systemic Amyloidosis)
- Shape: Diffuse, collagen-bound linear aggregates
- Size: 10-100 µm
- Location: Extracellular (liver, spleen, kidneys)
8. Fibrin-Amyloid (Microclots, Long COVID)
- Shape: String-like, thread or net-like filaments
- Size: 50-500 µm
- Location: Circulating blood, capillaries, microvessels
The list above mentions only one type of amyloid formation that has a string-like shape on the micrometer scale, which are the microclots associated with long COVID. But I couldn't get ChatGPT to cite any source which said that amyloid clots associated with COVID actually had a string-like shape, so ChatGPT may have been influenced by McCairn's post which I had shown it earlier.
The list above says that IAPP/amylin forms "sheet-like or intercellular ribbon deposits", but ribbons of IAPP typically have a diameter of about 10-15 nanometers.
I asked McCairn: "Is there some specific part of the papers you cited which says that formations amyloid protein have a tendency to form into a ribbon-like shape in the micrometer scale?" [https://x.com/henjin256/status/1928612282696671237] But he gave me the following non-answer:
Here we go again, you are not looking at the canonical amyloidogenic form, merely based on the size of the aggregations .
How many times do I have to tell you this? That is why I as the domain level expert uses the language as I see fit.
Especially when it reacts to all the diagnostic measurements used to detect amyloids.
ThT Fluorescence, SEM structural characteristics, RT-QuIC reactivity, Raman Spectra confirmation.
I replied: "You suggested amyloid structures have a 'scale-invariant preservation of fibrillar architecture' so they have a tendency to form into a ribbon-like shape on the micro-scale, and you cited two papers from 2017. Which part of the papers supports your point?" But I didn't get any answer.
A paper by Pretorius and Kell featured the following images of microclots, with this caption: "Representative micrographs of ThT-positive events passing through the flow cytometer. All micrographs are obtained at 20x magnification. Each group contains 6 micrographs from different individuals. The image on the left of each micrograph is obtained from the bright field channel (Ch01), and the image on the right is obtained from the fluorescent channel (Ch07). The number in the top left corner of each micrograph represents the event number within a given sample run." [https://www.researchsquare.com/article/rs-4507472/v1]
When I asked Douglas Kell if his group had also seen the kind of fiber-like microclots that were shown in McCairn's Substack post, he just replied "these experiments are quite different so comparisons are not usefully made". [https://x.com/dbkell/status/1928858289166561296] Then I asked him: "McCairn supposedly finds these mystery ribbons on slides of blood he receives in the mail from his followers. Have you also tried looking at samples of blood under a microscope to see if they contain similar formations, or if they contain amyloid microclots?" But he told me: "We have only studied plasma".
McCairn said: [https://x.com/KevinMcCairnPhD/status/1928898424038109639]
In the experiments conducted by @dbkell and colleagues, the whole blood is spun in a centrifuge, larger aggregates would be pulled to the bottom of the tube.
Spinning and looking at the plasma phase would leave the smaller amyloidogenic seeds in the plasma phase. This allows automated sorting through techniques like flow cytometry. This is a better approach for batch processing, you will miss the larger aggregations due to centripetal forces being greater on larger amyloidogenic forms.
Slide analysis is much slower, requires someone with trained eyes, is labor intensive, and requires the follow on tests of ThT staining, SEM/EDX, Raman Spec, for categorization.
Added in June 2025: I now asked McCairn again to show what part of the two papers from 2017 he cited supported his claim that aggregates of amyloid protein tend to organize into a ribbon-like shape on the micrometer scale. [https://x.com/henjin256/status/1929356877130838498] But he now quoted the following paragraphs from the Chiti et al. 2017 paper: [https://doi.org/10.1146/annurev-biochem-061516-045115]
These β-structured oligomers are able to grow further by self-association or through the addition of monomers, often with further and sometimes dramatic structural reorganizations, to form well-defined fibrils with cross-β structure and a high level of structural order (Figure 1). Alternatively, the disordered aggregates or native-like aggregates can grow without any major structural conversion and give rise to large amorphous deposits or native-like assemblies, respectively, retaining the structure characterizing the initial oligomers (Figure 1).
Such large aggregates, including amyloid, amorphous, or native-like assemblies, have links with human disease as they accumulate in well-defined pathological states. Tables 1 and 2 list the proteins and the disorders that have now been identified to be associated with the formation of amyloid fibrils or other types of aggregates, respectively. (Supplemental Tables 1 and 2 also list, for each protein, references reporting the identification of the protein in the aggregates and the characteristics of the aggregate type.) We have arranged both tables in terms of proteins rather than disorders to stress the fact that many of these proteins have been found to be involved in a variety of pathological conditions. Interestingly, immunoglobulins or their subunits are found in all the different types of protein aggregates, including amyloid (as in light-chain amyloidosis), amorphous (as in light-chain deposition disease), and native-like (as in Berger disease) structures, thus representing a remarkable manifestation of the multiplicity of pathways existing in protein aggregation and of the structures and morphologies that can be generated (24–26). Those proteins that form intracellular inclusions of types that are still debated, such as TDP-43 and p53, are included in Table 2 with a footnote explaining this uncertainty.
But I pointed out that Figure 1 illustrated typical nano-scale amyloid fibrils. And Supplemental Table 1 characterized the shape of various types of amyloid structures as "intrinsically disordered":
Then McCairn posted his microscope photos and wrote:
You're so retarded! This particular amyloid, is novel and not listed because you're looking at science being done in real time.
The principles of misfolding though, are likely the mechanism leading to the macroform and of course the species of protein undergoing change. Fibrin is inherently primed to make macromolecular structures, hence the amyloidogenic form is going to be larger.
Which is why I have gone to the effort of showing concordant structure across scales.
But I told him: "Post-COVID clots are not relevant to my question. You cited two pre-COVID papers to support a claim that amyloid aggregates have 'scale-invariant preservation of fibrillar architecture' and they form 'twisted ribbon-like or lamellar structures irrespective of protein species'." And McCairn replied: "That's because there is no post-COVID manuscripts showing the phenomenon, in the manner that I have, you're looking at it being made right now, and disseminated to the public. It is usual in scientific writing to point to key historical citations that demonstrate concordance within hypothetical frameworks." But he still didn't answer my question, so I told him: "We already know you claim that baby calamari clots have a tendency to form into a ribbon-like shape on the micrometer scale. The question was which part of the sources you cited supports the claim that the same applies to other types of amyloid formations."
But then McCairn said "there is a coherency in the epistemological grounding of the amyloid PRION formation", so I told him it sounded like great pseudo-profound bullshit: [https://x.com/KevinMcCairnPhD/status/1929507781163524103]
A user on Twitter said that the string-like object in McCairn's microscope image was too big to be an aggregate of amyloid protein, and it looked like dust or debris. McCairn cited a paper by Pretorius and Kell which said that "the fibrinaloid microclots that we observe are typically in the range 1–200 µm on their longest axis": [https://x.com/KevinMcCairnPhD/status/1930402739089223987]
However the text he quoted referred to this figure, which showed that the microclots of Pretorius and Kell did not have a string-like shape like McCairn's mystery fibrils:
The Died Suddenly movie was produced by Lauren Witzke, who was the producer of Stew's show and his movies until 2024. In April 2024 Stew Peters posted this tweet: "The @DiedSuddenly_ account has been hijacked by @LaurenWitzkeDE et al and is currently not being run by the Stew Peters Network." [https://x.com/realstewpeters/status/1776687243760918915] Around the same time he filed a lawsuit against Lauren Witzke's production company, where he also said that the Twitter account and website of Died Suddenly were now run by Witzke's crew. [https://www.courtlistener.com/docket/68403646/fokiss-inc-v-tlm-global-llc/, https://talkingpointsmemo.com/news/lawsuit-exposes-internal-feuds-and-inner-workings-of-stew-peters-extremist-media-empire]
In May 2025 the Died Suddenly crew announced that they were raising funds for a new film called "DS2: Nano Sapiens", which was going to be directed by Matthew Skow, who also directed the Died Suddenly film together with Nicholas Stumphauzer. [https://x.com/DiedSuddenly_/status/1927822317607915557]
Jikkyleaks said that the cast of the film was full of glowies, but Kevin McCairn replied "LMFAO at the list of cretins in that list, Died Suddenly needs to die in ways only I can think up if they're grifting for funds to buy equipment": [https://x.com/Jikkyleaks/status/1928632048287355207]
One of the people featured in the film was Maria Zeee, but a few weeks earlier Kevin McCairn appeared on Maria Zeee's show together with Richard Hirschman, who was the main star of the Died Suddenly film:
Several other people featured in the Nano Sapiens film are also connected to the story about the calamari clots: [https://ds2nano.com]
In June 2025 Nicolas Hulscher published this tweet, where he promoted McCairn's Substack post about the mini calamari clot that McCairn supposedly found in the blood of a 3-year-old: [https://x.com/NicHulscher/status/1929689987974385879]
Two weeks earlier Hulscher interviewed Greg Harrison and Richard Hirschman about the calamari clots. McCairn told me he had informed Hirschman about how Harrison was a scammer, but for some reason Hirschman is still fine with going on podcasts with Harrison: [https://x.com/KevinMcCairnPhD/status/1928128047515062379]
In May 2025 McCairn and Hirschman also went on the show of Maria Zeee, which is now part of Vigilant News Network that was founded by TWC's founder Foster Coulson:
Hulscher is the "foundation administrator" of McCullough Foundation, and he also runs the Twitter account of McCullough Foundation. Peter McCullough is the Chief Scientific Officer of The Wellness Company.
TWC's Chief Marketing Officer used to be Christopher Alexander, whose work experience includes having "successfully secured over 300 million dollars in contracts for Information Operations, PSYOP, and intelligence support" and being "recognized as a leader in disinformation, misinformation, and counter-propaganda campaigns". [https://beyondthemaze.substack.com/p/the-wellness-company] TWC's cofounder and the CEO of Zelenko Labs is David Lopez, whose bio says that he is a "Subject Matter Expert (SME) on Tactical Operations, Classified Global Counter-Terrorism Operations/Terrorist Countermeasures" and that he "serves as a special projects manager for Blackwater and conducts security operations around the world for select clients". [https://missionsixzero.com/our-team/david-lopez/]
In 2024 I scraped the reposts of about 80 accounts that I suspected to be bots that promoted content about COVID from the controlled alternative media. When I sorted COVID-related accounts by the number of reposts by suspected bots divided by their number of followers, McCullough Foundation ranked second. [bot2.html#Reposts_by_bots_compared_to_number_of_followers] The 4th highest ranking user was William Makis, who was on the "Chief Medical and Scientific Board" of TWC Canada which is now defunct. [https://web.archive.org/web/20230909165713/https://twccanada.health/]
Makis presents ivermectin and fenbendazole as miracle cures for turbo cancer. But before COVID both of them were offered as cures for Morgellons disease: [https://x.com/Humanparasites8/status/1121415232071581696]
A forum post from 2016 said: "I've also read that a lot of people who are suffering with morgellons have had some huge success with fenbendazole." [https://www.skinpick.com/comment/16074] A tweet from 2021 said: "I was suffering with an unidentified disease call MORGELLONS. Doctors thought we were all crazy. I used cattle wormer - FENBENDAZOLE FOR 3 YEARS and was pretty much cured!" [https://x.com/WETRIPP/status/1429176109745139715] A case study from 2011 described the case of a man who had earlier thought he was poisoned by the Japanese mafia, but he then started to think he had Morgellons disease, so he bought ivermectin in bulk from an online veterinary supplier, and he ended up developing ivermectin toxicity. [https://www.sciencedirect.com/science/article/pii/S0033318211000521]
In 2024 Hulscher and McCullough coauthored a paper with Raphael Stricker, who is possibly the main person responsible for popularizing the hoax about Morgellons disease. In 2021 Stricker also coauthored a paper with the TWC Chief Medical Board members McCullough and Risch: [https://www.researchgate.net/profile/Raphael-Stricker]
Stricker was one of two people on the advisory of Morgellons Research Foundation, which was founded by Mary Leitao who coined the term Morgellons disease. Their website featured these photos of Morgellons filaments in the blood of a 3-year-old boy, which are reminiscent of the mysterious filament that McCairn found in the blood of a 3-year-old: [http://web.archive.org/web/20021121193025/https://www.morgellons.org/]
In 2019 the California Medical Board issued a complaint against Stricker because he had prescribed ivermectin as a treatment for Morgellons disease without obtaining informed consent. [https://lymescience.org/rogues/Raphael-Stricker/Raphael-Stricker-accusation-2019.pdf] Stricker was kicked out of academia because he falsified data in a study about AIDS, and afterwards he worked as an associate director of a penis enlargement clinic. [https://forbes.com/forbes/2007/0312/096.html?sh=6f92216476c6, https://grants.nih.gov/grants/guide/notice-files/not93-177.html]
Ana Maria Mihalcea said that calamari clots are "made from these filaments that Clifford Cardicom calls cross-domain bacteria or Morgellons filaments", and she showed these images of Morgellons filaments she found in Hirschman's clots: [https://rumble.com/v4buruf-truth-science-and-spirt-episode-6-rubbery-clots-conversation-with-richard-h.html?start=2269]
Then Hirschman told Mihalcea "I had a live blood analysis of my own blood and my blood had some of those filaments in it too" (even though it's not clear if by filaments he meant Morgellons filaments or some other type of filaments). Mihalcea said that Hirschman's clots contained quantum dot micro robots, and she presented a microscope video of blinking lights as evidence, but Hirschman told her "you got some pretty daggum solid proof behind you when you're showing the actual images, you're showing the blinking lights".
The only scientific paper about calamari clots I have found was published in the journal IJVTPR. One of the people on the editorial board of the journal is Shimon Yanowitz. [https://ijvtpr.com/index.php/IJVTPR/about/editorialTeam] He said that the photo below showed a ribbon that he found in his blood even though he was not vaccinated, but he said it may have come from either chemtrails or from shedding from vaccinated people. He said that the ribbon was possibly a Morgellons filament, and that it looked very mean and it made red blood cells nervous: [https://www.bitchute.com/video/9ZFHWKEYxlCa/]
The term "turbo cancer" was first introduced in September 2021 in Arne Burkhardt's pathology conference. [turbo.html] People in the conference also said that vaccines contained mini robots, graphene oxide, a parasite called Treponasoma cruzi, and objects that looked like SIM cards. One person in the conference showed this microscope image of vaccinated blood, which she said showed a synthetic fiber that may have consisted of graphene, but another person suggested it was a Morgellons fiber: [https://www.bitchute.com/video/jRX63Ohu0l0g, time 18:28]
One of the people in McCairn's circle is Johanna Deinert. She also worked together with Arne Burkhardt and helped run his website, which is rather suspicious considering how Burkhardt appears to have been a Quinta Columna type plant in the alt media.
Greg Harrison posted these screenshots of his AI conversation: [https://x.com/Greg21143362/status/1930548136826511852/photo/2]
Greg's AI said: "You have now outmaneuvered this disruptive actor by staying within strict scientific professionalism." But the way he outmaneuvered me was by not answering my questions about his methodology, by not countering the evidence I showed that he faked his data, by saying I'm a CCP troll, and by blocking me.
It's interesting how the last paragraphs of the first page are surrounded by double asterisks, which are used to format bold text in Markdown. Kevin McCairn also left in Markdown bold formatting in one part of his Substack post. I thought it looked like text copied from some AI utility, because Substack doesn't even support Markdown. [https://substack.com/home/post/p-164383206] When I brought up the topic to McCairn, he said: "You're looking at a summary, generated off the article, that some one who I trust to review the document said it needed, the LLM output was better and more concise than my attempt, which leans towards a more verbose style. Hence leaving the markdown in for transparency." (However I don't buy the excuse that he "left the markdown in for transparency", because the Markdown formatting was not even a clear sign that the text was generated by AI, and it would've been more transparent to explicitly write that the text was AI-generated.)
Greg's AI said I don't have any institutional affiliation or credentials listed. But I don't have any institutional affiliation or credentials, because I'm just a conspiratard.
Greg's AI said that I had 5,979 tweets, which was "High-volume posting typical of accounts involved in active information management or disruption activities." But that was during a period of almost 2 years, which I would say is a medium volume of tweeting. Greg has posted about 90,000 tweets over a period of about 5 years.
Greg's AI said: "Early predictive modeling (e.g., aggregation potential screens) is part of the scientific process of hypothesis generation and does not represent final experimental results." He was referring to his AI-generated table of fake ORFs, which was supposed to show the "aggregation potential" of each ORF. But in order to verify a statement like "ORF29 is 60 amino acids long and has 50% Q/N content" experimentally, you'd have to sequence the genome of SARS-CoV-2 and then analyze the sequence through bioinformatics. But SARS-CoV-2 has already been sequenced tens of millions of times, and likely none of the sequences include a 60 aa ORF with 50% Q/N content, except possibly some erroneous sequences. If Greg wanted to show his ORFs are real, he could simply post the nucleotide range of each of his ORFs in Wuhan-Hu-1. But he won't do that, because he won't be able to show that there's any 60 aa ORF with 50% Q/N content.
Greg's AI said it was a "personal attack" when I said his ORFs were AI hallucinations. I don't know if the AI meant a personal attack against itself or against Greg. But Greg's AI is high on its own supply, because it even said these images were not AI hallucinations, but the reason why the text in the images was garbled was because the images used a "phonetic scrambling technique" employed by bioweaponeers: [https://x.com/Greg21143362/status/1888539927929037124]
